Animal Strain view

ACRC Stock ID_2	Strain ID	Full Scientific Strain Name	Repository Status	Stock Status	Species	Strain Type	Lab of Origin	Original Stock ID	Genetic background	Suggested Breeding Scheme (f)X(m)	Eye/Coat Colour	Information On Strain Specifics	Genotype litters required	Date Of Import	Number of (f) and (m) Imported	MTA ID	Notes
acrc:23000038	Notch1 Flox/Flox	Notch1 Flox/Flox	Public	Live	Mus Musculus	Tg, Targeted KO	Freddy Radtke EPFL		B6	homo X homo	Black Coat color					Freddy Radtke EPFL	RL lab
acrc:21000001	129X1	129X1/SvJNcbs	Public	Cryo-S	Mus Musculus	WT	JAX -> JNcbs	JAX# 000691		inbred (sibling X sibling)	pink-eyed, light-bellied, light chinchilla	6-9 pups per litter	N		= old stock imported in 2013 or prior - Filiation unknown	Global JAX/NCBS/Instem transfer agreements_2017	= old stock imported in 2013 or prior - Filiation unknown- [old ID = acrc:00001]
acrc:21000398	ACE2 KO1- exon2Del [B6ND2]	B6N;DBA2-Ace2 em1Mgef/Blisc (g52-ATGexon2 deletion)	Public	Live, Cryo-S	Mus Musculus	KO - crispr/cas Targeted deletion	MGEF / BLiSC		B6NJ/Ncbs -2017							BLiSC- ACRC	Crispr/Cas targeted exon2 deletion- please visit our website for more details on the different series of mouseAce2KO and humanizedACE2 animals generated at MGEF. https://www.ncbs.res.in/research-facilities/acrc-ace2
acrc:21000397	ACE2 KO2 [B6ND2]	B6N;DBA2-Ace2em2Mgef/Blisc for the (g52-g55 47Kb deletion)	Public	Cryo-S	Mus Musculus	KO - crispr/cas Targeted deletion	MGEF / BLiSC		B6ND2 being backcrossed on B6/NJNcbs backrground					Saturday, August 1, 2020		BLiSC- ACRC	Crispr/Cas targeted full gene deletion- mouse model developed at MGEF/ BLiSC facility- in the process of being characterised / analysed and stock amplified- Stock ready for pre-order- Please NOTE that we have also generated a knock-IN humanized hACE2 KI strain and several K18-hACE2 transgenic lines- -search for " ACE2 " in the "Strain Name" search field of this database for more details- please visit our website for more details on the different series of mouseAce2KO and humanizedACE2 animals generated at MGEF. https://www.ncbs.res.in/research-facilities/acrc-ace2
acrc:21000245	Adipoq-CreER	B6.129Tg(Adipoq-cre/Esr1*)1Evdr/JNcbs	Public	Live, Cryo-S	Mus Musculus	Transgenic (Inducible, Recombinase-expressing)	JAX -> JNcbs	JAX# 24671	B6	Hemizygote x Noncarrier OR Noncarrier x Hemizygote	black			Wednesday, February 21, 2018	2 (Noncarrier X Hemi) breeding pairs	Global JAX/NCBS/Instem transfer agreements_2017, SRD	[old ID = acrc:00011]
acrc:21000376	Adipoq-CreER, tdT	B6.129Tg(Adipoq-cre/Esr1*)1Evdr/JNcbs , B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/JNcbs (tdTAi14)	Public	Live	Mus Musculus	compound	JAX -> ACRC	compound of JAX# 24671 and JAX# 007914	B6							JAX
acrc:21000434	Adipoq-CreER, tdT, Rag1KO	B6.129Tg(Adipoq-cre/Esr1*)1Evdr/JNcbs , B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/JNcbs (tdT), B6.129S7-Rag1tm1Mom/JNcbs	Public	Live, Cryo-S	Mus Musculus	compound	JAX-> ACRC	compound of JAX# 24671 and JAX# 007914 and Jax# 002216	mixed							Global JAX/NCBS/Instem transfer agreements_2017
acrc:21000543	Adipoq-CreER, tdT, Rap fl	B6.129Tg(Adipoq-cre/Esr1*)1Evdr/JNcbs, B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/JNcbs (tdTAi14), B6.Cg-Rptortm1.1Dmsa/JNcbs	Public	Live	Mus Musculus		JAX-> Ncbs	compounds of JAX#007914, JAX#013188, JAX#24671	mixed							JAX, ACRC
acrc:23000024	Adipoq-CreER, tdT; IFN-γR fl/fl	B6.129Tg(Adipoq-cre/Esr1*)1Evdr/JNcbs , B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/JNcbs (tdTAi14); C57BL/6N-Ifngr1tm1.1Rds/JNcbs ; interferon gamma receptor 1 flox/flox	Public	Live	Mus Musculus	Compound	JAX -> NCBS	Adipoq-CreER, tdT- compound of JAX# 24671 and JAX# 007914 and IFNγR- JAX#025394								JAX
acrc:22000064	Ai32	B6.Cg-Gt(ROSA)26Sortm32(CAG-COP4*H134R/EYFP)Hze/JNcbs	Public	Live	Mus Musculus	Congenic, Targeted Mutation	JAX -> NCBS (Imported for Prof. Upi Bhalla)	JAX# 024109		Homozygote x Homozygote, When maintaining a live colony, homozygous mice may be bred together.	Black Coat color			Tuesday, August 9, 2022	2M + 2F		Imported for Prof. Upi, received on 09 Aug. One female was observed with a kinked tail.
acrc:21000310	Ai9/Ai9; Lhx2cKO/ Lhx2cKO	Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/Ncbs ; Lhx2tm1Monu/Ncbs	Public	Live, Cryo-S	Mus Musculus	coumpound, cKO	Shubha Tole (TIFR Mumbai) Cryo + JAX	compound from JAX#007909 + MGI:3772179	mixed - original Cryo males were agouti					Tuesday, November 22, 2016		Shubha Tole (TIFRmumbai) for Cryo Stocks, JAX, BM	BM - imported new set of animals for rederivation and cryo from TIFRmumbai 6 March 2021.
acrc:21000252	Ai95D	B6;129SGt(ROSA)26Sor<tm95.1(CAGGCaMP6f)Hze>/JNcbs	Public	Live, Cryo-S	Mus Musculus	Targeted (Conditional ready (e.g. floxed), No functional change, Reporter)	JAX -> JNcbs	JAX# 24105	mixed B6;129	Heterozygote x Wild-type OR Wild-type x Heterozygote	Black			Wednesday, February 21, 2018	2 (HET X WT) breeding pairs	Global JAX/NCBS/Instem transfer agreements_2017, GH	[old stock ID =acrc:00012]
acrc:21000258	Ai95D fl/+, Pcp2Cre/+	Ai95(RCL-GCaMP6f)-D flox/+, Pcp2Cre/+	Public	Live	Mus Musculus	compound	multiple	multiple								see individual alleles	see individual allele details
acrc:21000337	Ai95D Flox/+, Stim1 Flox/+	B6;129SGt(ROSA)26Sor<tm95.1(CAGGCaMP6f)Hze>/JNcbs , Stim1^tm1Rao/Ncbs	Public	Cryo-S	Mus Musculus		Anjana Rao Lab, La Jolla Institute (CA), JAX	compound from JAX# 24105 and MGI:3778911								Anjana Rao Lab, La Jolla Institute (CA), JAX
acrc:21000338	Ai95D flox/flox, Stim1 flox/flox	B6;129SGt(ROSA)26Sor<tm95.1(CAGGCaMP6f)Hze>/JNcbs , Stim1^tm1Rao/Ncbs	Public	Live	Mus Musculus		Anjana Rao Lab, La Jolla Institute (CA), JAX	compound from JAX# 24105 and MGI:3778911								Anjana Rao Lab, La Jolla Institute (CA), JAX
acrc:24000048	Alb-Cre	B6N.Cg-Speer6-ps1/J<Tg(Alb-Cre)21Mgn/J	Public	Live, Cryo-S	Mus Musculus		ULLAS_TIFR HYD	Stock - 018961	B6N/J
acrc:21000190	aMHC-PARP1	B6;D2-Tg(AlphaMHC-humPARP1)1/Ncbs	Public	Live, Cryo-S	Mus Musculus	Transgenic, Random Insertion	MGEF_DP	MGEF	B6D2-F2/JNcbs	needs to be backcrossed to C57BL/6J			YES	Wednesday, November 9, 2016	only 1 Founder animal (#26)	NCBS/INSTEM_MGEF MTA1, MGEF / DP	[old stock ID=MGEF:00001].. MGEF_DP_ microinjection Project 2016- injected in B6D2F2 oocytes- Overexpression of Human PARP1 under alphaMHC promotor- Cardiac phenotype observed- genotyping (300bp amplicon)= Alpha MHC Fw: TACATGGAGTCCTGGTGGGA ; hPARP1 RV3: CATCAAACATGGGCGACTGC
acrc:21000331	ANT2lox	STOCK Slc25a5tm1.1Nte ?? Ant2 floxed	Public	Live, Cryo-S	Mus Musculus	Targetted KI	Cryo for Ullas Kolthur - TIFRmumbai - JAX	Is this JAX#029482 ?	C57BL6/EiJ					Tuesday, January 10, 2017		Ullas Kolthur - TIFRmumbai for CryoStocks, JAX	original Stock ID to be clarified
acrc:22000012	ApjCreER, VegfR2flox	ApjCreER, STOCK Kdrtm2Sato/JNcbs [VegfR2 ^e3loxP]	Public	Live	Mus Musculus	Compound	Red-Horse Lab - Stanford University and JAX	VegfR2flox= JAX#018977								Red-Horse Lab - Stanford University, JAX
acrc:21000298	Arl13b-mCherry; Centrin2-GFP	STOCK Tg(CAG-Arl13b/mCherry)1Kvand; Tg(CAG-EGFP/CETN2)3-4Jgg/KvandJNcbs	Public	Live	Mus Musculus	double Transgenic (Reporter)	JAX ->NCBS	JAX# 027967		Hom,hom x hom,hom to maintain double Homo stock	agouti			Thursday, September 20, 2018	1 breeding pair (double homozygotes)	Global JAX/NCBS/Instem transfer agreements_2017	Double homozygous mice are viable and fertile. In 2019 colonists at The Jackson Laboratory noted that double homozygous mice develop ear, eye, and nose sores by 12-14 weeks of age. Therefore, JAX colony is maintained by breeding females homozygous for the ARL13B-mCherry transgene and hemizygous for the Centrin 2-GFP transgene (hom hemi) with males hemizygous for the ARL13B-mCherry transgene and homozygous for the Centrin 2-GFP transgene (hemi hom). - [old stock ID=acrc:00013]
acrc:21000295	Ascl1-CreERT2	STOCK Ascl1tm1.1(Cre/ERT2)Jejo/JNcbs	Public	Live, Cryo-S	Mus Musculus	targeted mutation	JAX ->NCBS	JAX# 12882	mixed (129S6/SvEvTac; C57BL/6 ; ICR outbred)	recommended: Heterozygote x +/+ WT sibling	mixed - albino to black	Homozygotes die within hours of birth due to CNS and PNS disruptions in neural development		Thursday, September 20, 2018	2 Heterozygote males	Global JAX/NCBS/Instem transfer agreements_2017	[old Stock ID=acrc:00014]
acrc:21000390	Asrij KO#13	Asrij KO#13 (= Ociad1 KO #13)	Public	Cryo-S	Mus Musculus		JNCASR - MI		Mixed strain: C57BL/6N × CBA					Wednesday, January 8, 2020	homozygote male donors	RIKEN - CDB, ACRC - JNCSAR -Maneesha Inamdar	Stock Cryopreserved for Maneesha Inamdar (JNCSAR).
acrc:21000391	Asrij KO#16	Asrij KO#16 (= Ociad1 KO #16)	Public	Cryo-S	Mus Musculus		JNCASR - MI							Monday, July 1, 2019	homozygote male donors	RIKEN - CDB, ACRC - JNCSAR -Maneesha Inamdar	Stock Cryopreserved for Maneesha Inamdar (JNCSAR).
acrc:21000392	Asrij KO#59	Asrij KO#59 (= Ociad1 KO #59)	Public	Live, Cryo-S	Mus Musculus		JNCASR - MI							Monday, July 1, 2019	homozygote male donors	RIKEN - CDB, ACRC - JNCSAR -Maneesha Inamdar	Stock Cryopreserved for Maneesha Inamdar (JNCSAR).
acrc:21000071	Asrij Lox #13	Asrij Lox #13 (= Ociad1 Lox #13)	Public	Cryo-S	Mus Musculus		RIKEN-> Ncbs		original: C57BL/6 × CBA	Homozygote X Homozygote	black/agouti					Riken, Ncbs, Prof. Maneesha Inamdar	Stock Cryopreserved for Maneesha Inamdar (JNCSAR). [old Stock ID=acrc:00015]
acrc:21000114	Asrij Lox #16	Asrij Lox #16 (= Ociad1 Lox #16)	Public	Cryo-S	Mus Musculus		RIKEN -> Ncbs		original: C57BL/6 × CBA (transgenic)	Homozygote x Homozygote	black/agouti					Riken, Ncbs, Prof. Maneesha Inamdar	[old stock ID = acrc:00016]
acrc:21000112	Asrij Lox #59	Asrij Lox #59 (= Ociad1 Lox #59)	Public	Live, Cryo-S	Mus Musculus		RIKEN -> Ncbs		original: C57BL/6 × CBA (transgenic)	Homozygote x Homozygote	black/agouti					Prof. Maneesha Inamdar (JNCASR & inStem)	Stock Cryopreserved for Maneesha Inamdar (JNCSAR).
acrc:21000264	Atoh1-cre/ESR1 (B6N)	Atoh1-cre/ESR1 (B6/N)	Public	Cryo-E	Mus Musculus		RIKEN-CDB (+ JAX?)		B6/N	B6/N WT X (+/-)				Monday, January 29, 2018	1 CryoVial (= 42 2-cell embryos)	RIKEN-CDB + Raj Ladher Lab + JAX?
acrc:21000270	Atoh1-cre/ESR1 (FVB/N)	Atoh1-cre/ESR1/ Ncbs (FVB/N) [STOCK Tg(Atoh1-cre/Esr1*)14Fsh] also known as [Math1-CreERT2]	Public	Live	Mus Musculus	Transgenic (Inducible, Recombinase-expressing)	RIKEN-CDB + JAX	JAX#007684	FVB/NJ	FVB/N X (Tg/+)				Monday, January 29, 2018	1 CryoVial (= 44 2-cell embryos)	RIKEN-CDB + JAX
acrc:21000195	Axin2-d2EGFP	Tg(Axin2-d2EGFP)5Cos/Ncbs	Public	Live, Cryo-S	Mus Musculus	Transgenic-Reporter, Random Insertion	Frank Costantini, Columbia University- (NCBS Rederived from Shubha Tole-Mumbai TIFR, Aug2016)	MGI:3836891	mixed			13 pups per litter at TIFR-Mumbai; NCBS=?		Friday, August 12, 2016	Rederived via embryo Transfer from Shubha Tole-TIFR Mumbai- Stocks -	From Frank Costantini, Columbia University, Shubha Tole (TIFRmumbai) for cryo stock	MTA: Frank Costantini, Columbia University & Ramkumar Sambasivan direct Agreement-
acrc:21000288	Axin2-d2EGFP, tdTAi14	Tg(Axin2-d2EGFP)5Cos/Ncbs , B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/JNcbs (tdTAi14)	Public	Live	Mus Musculus	compound	Frank Costantini, Columbia University + JAX	MGI:3836891 + JAX# 007914	mixed							Frank Costantini, Columbia University, , JAX
acrc:21000203	B-Raf KO-631	B6;129-BRAF 631/Ncbs (C57BL6/NJ)	Public	Live	Mus Musculus	targeted floxed Knock-Out	KCVI, OHSU, Portland	OHSU # 631	mixed B6/NJ,129		agouti	6-9 pups/ litter		Friday, January 6, 2017	1 Male + 1 Female ?	OHSU, ACRC	DP lab import- generated on C57BL6/NJ background
acrc:21000226	B-Raf KO-631, PGKCre	BRAF 631/Ncbs, Tg(Pgk1-cre)1Lni/Ncbs	Public	Live	Mus Musculus	compound	KCVI, OHSU, Portland; Pasteur Institute Paris (Yvan Lallemand)	OHSU # 631 + MGI:2178050	mixed (C57Bl6/NJOhsu, 129, BALB/c; C57BL/6J)/Ncbs							KCVI, OHSU,, Pasteur Institute - Paris
acrc:21000369	B2m KO	B6.129P2-B2mtm1Unc/DcrJNcbs	Public	Live, Cryo-S	Mus Musculus	Targeted (Null/Knockout)	JAX	JAX#002087		Homozygote x Homozygote	black			Friday, September 13, 2019	2 breeding pairs	JAX to TIFRHyd	TIFRHyd
acrc:21000311	B5/EGFP	FVB.Cg-Tg(GFPU)5Nagy	Public	Cryo-S	Mus Musculus	Transgenic (Reporter)	cryo for Shubha Tole (TIFR Mumbai) + JAX	JAX#003516						Tuesday, November 22, 2016		Shubha Tole (TIFRmumbai) for Cryo Stocks, JAX
acrc:21000249	B6 PVcre	B6.129P2Pvalb<tm1(cre)Arbr>/JNcbs	Public	Live, Cryo-S	Mus Musculus	Targeted (Recombinase-expressing)	JAX	JAX# 17320	B6	HOMO X HOMO	Black	parvalbumin is expressed in sperm; use of male PV-Cre mice may result in unwanted germline recombination and global recombination.	preferable to check genotype of breeders	Wednesday, February 21, 2018	2 (HOMO X HOMO) Breeding Pairs	JAX	JAX- When maintaining a live colony, these mice can be bred as homozygotes. Of note: parvalbumin is expressed in sperm; use of male PV-Cre mice may result in unwanted germline recombination and global recombination. USB
acrc:21000004	B6/J	C57BL/6JNcbs	Public	Cryo-E, Cryo-S	Mus Musculus	WT	JAX -> JNcbs	JAX# 000664		______________________________ inbred siblings (C57BL/6J X C57BL/6J)	__________________ black	____________________________________________ average litter size of 6-8 pups after the 2nd litter. Almost systematic cannibalism of the first litter and frequent cannibalism of subsequent litters - Around 50% male /female ratio in litters	N		= old stock imported in 2013 - Filiation unknown	Global JAX/NCBS/Instem transfer agreements_2017	= old stock Imported in 2013. [old ID = acrc:00002]
acrc:21000238	B6/J_2017	C57BL/6JNcbs_2017	Public	Live, Cryo-E, Cryo-O, Cryo-S	Mus Musculus	inbred	JAX -> JNcbs	JAX#000664	B6/J_2017					Wednesday, September 13, 2017	4 breeding pairs	Global JAX/NCBS/Instem transfer agreements_2017	Sept 2017 = B6/J_2017 = newly imported stocks different from OLD stock (= B6/J). [old ID=acrc:00008]
acrc:21000368	B6/J_2019	C57BL/6JNcbs [2019]	Public	Live, Cryo-S	Mus Musculus		JAX	JAX#000664						Friday, September 13, 2019	2 breeding pairs	JAX to TIFRHyd
acrc:21000042	B6D2 F1	B6JD2F1/JNcbs	Public	Live, Cryo-E	Mus Musculus	WT F1 hybrid	NCBS AF / ACRC	components of JAX# 000664 and JAX# 000671		(f)C57Bl/6J X (m)DBA2/J	black		N			ACRC	JAX: Useful as a genetic background for transgenic/knockout creation, as well as other deleterious mutations. Research applications include radiation and behavioral research, and safety and efficacy testing, bioassays of nutrients, drugs, pathogens, and hormones. [old stock ID = acrc:00003]
acrc:21000363	B6J albino	B6(Cg)-Tyrc-2J/JNcbs	Public	Live, Cryo-E, Cryo-S	Mus Musculus		JAX	JAX#000058	B6J	Homozygote X Homozygote	albino / white			Friday, September 13, 2019	3 breeding pairs	JAX	B6(Cg)-Tyrc-2J/J, or B6-albino mice, are C57BL/6J mice that carry a mutation in the tyrosinase gene. Pigment is completely absent from skin, hair and eyes in mice homozygous for Tyrc-2J. This unique characteristic makes these mice ideal for creation of novel strains with targeted mutations (gene knockouts) on the B6J background.
acrc:21000547	B6N-20 / CBA-21	F1 production from C57BL/6NJNcbs [2020] X CBA/JNcbs [2021]	Public	Live	Mus Musculus	Hybrid F1	ACRC	compund of JAX#005304 & JAX#000656	mixed							JAX, MGEF / BLISC	Hybrid stocks- at MGEF & ACRC we Use these stocks as Foster mice for embryo transfer rederivation procedures- good mothers.
acrc:21000504	B6N-20/CBA	F1 production from C57BL/6NJNcbs [2020] X CBA/JNcbs [2017]	Public	Live	Mus Musculus	Hybrid F1	NCBS	components of JAX#005304 X JAX#000656								JAX
acrc:21000493	B6N-20/D2	F1 production from C57BL/6NJNcbs [2020] X DBA/2JNcbs [2018]	Public	Live	Mus Musculus	Hybrid F1	ACRC	compund of JAX#005304 & JAX#000671								MGEF / BLiSC, JAX
acrc:21000545	B6N-20/D2-21	F1 production from C57BL/6NJNcbs [2020] X DBA/2JNcbs [2021]	Public	Live	Mus Musculus	Hybrid F1	ACRC	compund of JAX#005304 & JAX#000671								JAX, MGEF / BLISC
acrc:23000006	B6N/J_2022	C57BL/6NJNcbs	Public	Live	Mus Musculus	Inbred Strain	JAX -> NCBS	JAX#005304		Inbreeding	Black Coat color			Friday, November 25, 2022	4F and 4M	JAX	Arrived on 24 Nov 2022. These are from the standard barrier JAX facility and are planned to rederive to SOPF status.
acrc:24000053	B6N22 D2/21 F1	B6N22 D2/21 F1	Public	Live, Cryo-S	Mus Musculus	wild type hybrid	MGEF		B6N/J *DBA/2	B6N/J *DBA/2
acrc:21000290	B6NCBA_F1	C57BL/6NJNcbs [2017] ; CBA/JNcbs [2017]	Public	Live	Mus Musculus	Hybrid _F1	NCBS	components of JAX#005304 X JAX#000656	hybrid	male CBA/JNcbs [2017] X female C57BL/6NJNcbs [2017]	agouti					JAX + NCBS	Hybrid stocks- at ACRC we Use these stocks as Foster mice for embryo transfer rederivation procedures- good mothers
acrc:21000441	B6NJ_2020	C57BL/6NJNcbs [2020]	Public	Live, Cryo-E, Cryo-S	Mus Musculus	inbred	JAX	JAX#005304	B6N	inbred	black		no but genetic monitoring recommended	Friday, November 27, 2020	6 breeding pairs	JAX
acrc:21000507	BALB/cJ_2021	BALB/cJNcbs [2021]	Public	Live, Cryo-E, Cryo-S	Mus Musculus		JAX	JAX # 000651						Thursday, June 24, 2021	4 breeding pairs	JAX
acrc:21000066	BALBc	Balb/cJNcbs	Public	Discontinued	Mus Musculus	WT	JAX -> JNcbs	JAX# 000651		inbred (sibling X sibling)	white albino	challenging breeder			= old stock imported in 2013 or prior - Filiation unknown	Global JAX/NCBS/Instem transfer agreements_2017	= old stock imported in 2013 or prior - Filiation unknown. [old stock ID=acrc:00005]
acrc:21000254	BALBc_2018	BALB/cJNcbs [2018]	Public	Cryo-S, Discontinued	Mus Musculus	WT	JAX	JAX # 651		inbred (sibling X sibling)	albino white		no	Wednesday, February 21, 2018	3 breeding pairs	JAX	@JAX- BALB/cJ Key traits include a susceptibility to developing the demyelinating disease upon infection with Theiler's murine encephalomyelitis virus. The BALB/cJ substrain is susceptible to Listeria, all species of Leishmania, and several species of Trypanosoma, but is resistant to experimental allergic orchitis (EAO).
acrc:21000057	beta1Flox	B6;129-Itgb1tm1Efu/JNcbs (integrin beta 1 (fibronectin receptor beta)	Public	Cryo-S	Mus Musculus	targeted	JAX -> JNcbs	JAX# 004605	B6;129	Homozygote x Homozygote	Agouti / dark brown	8-12 pups per litter	No			Global JAX/NCBS/Instem transfer agreements_2017, SR	[old stock ID = acrc:00006]
acrc:21000149	beta1Flox, K14Cre (CD1)	beta1^flox/flox, K14Cre (CD1)	Public	Cryo-S	Mus Musculus												SR
acrc:21000187	betaCat-Flox	B6.129-Ctnnb1tm2Kem/Ncbs (beta-Catenin cKO)	Public	Live, Cryo-S	Mus Musculus	Knockin, conditional knock-out	Rolf Kemler, MPI-IE Freiburg (NCBS imported via Shubha Tole-TIFR Mumbai)	MGI:2148567 also available as JAX: 004152	mixed			13 pups per litter at TIFR-Mumbai; NCBS=?		Friday, August 12, 2016	Rederived via embryo Transfer from Shubha Tole-TIFR Mumbai- Stocks	Rolf Kemler, MPI-IE Freiburg and Ramkumar Sambasivan direct agreement, Shubha Tole (TIFRmumbai) for cryo stock	MTA: Rolf Kemler, MPI-IE Freiburg and Ramkumar Sambasivan direct agreement- ST-CryoStocks. [old stock ID=acrc:00007]
acrc:21000196	betaCat-loxEx3	Ctnn1b tm1Mmt (beta-Catenin GOF)	Public	Live, Cryo-S	Mus Musculus	Knockin, conditional Gain of function	Makoto Mark Taketo, Kyoto University (NCBS imported via Shubha Tole-TIFR Mumbai)	MGI:1858008	mixed			16 pups/litter at TIFR Mumbai - NCBS=?		Friday, August 12, 2016	Rederived via embryo Transfer from Shubha Tole-TIFR Mumbai- Stocks	Makoto Mark Taketo, Kyoto University, Shubha Tole (TIFRmumbai) for cryo stock	MTA: Makoto Mark Taketo, Kyoto University and Ramkumar Sambasivan direct agreement-
acrc:21000389	c-met flox	FVB;129P2-Mettm1Sst	Public	Cryo-E, Cryo-S	Mus Musculus	Targeted (Conditional ready (e.g. floxed), No functional change)	JAX -> RCB -> ACRC	JAX#016974	mixed - backcrossed on FVB/NJ							JAX, Masum Saini (Regional Centre for Biotechnology, NCR Delhi)	From Masum Saini (Regional Centre for Biotechnology, NCR Delhi) - 2019 - for Cryo and Rescue as original imported breeder were not breeding well at all.
acrc:21000372	C3HFe	C3HeB/FeJNcbs [2019]	Public	Cryo-E, Cryo-S	Mus Musculus		JAX	JAX#000658		inbred- Sibling x Sibling	agouti			Friday, September 13, 2019	2 breeding pairs	JAX	This general purpose strain shares a common origin with C3H/HeJ and C3H/HeOuJ. Unlike C3H/HeJ, it carries a normal allele at the Tlr4 locus, but is homozygous for Pde6brd1, which causes retinal degeneration. C3HeB/FeJ inbred mice have been found to be extremely susceptible to virulent Mycobacterium tuberculosis. They develop pulmonary tuberculosis and die within 25-28 days of infection with 105 CFU of Erdman strain of M. tuberculosis (Kramnik et al, 1998). Several QTL have been identified that contribute to the M. tuberculosis susceptibility (Sissons et al., 2009)
acrc:21000508	C3HFe_2021	C3HeB/FeJNcbs [2021]	Public	Live, Cryo-E	Mus Musculus		JAX	JAX#000658						Thursday, June 24, 2021	2 breeding pairs	JAX	This general purpose strain shares a common origin with C3H/HeJ and C3H/HeOuJ. Unlike C3H/HeJ, it carries a normal allele at the Tlr4 locus, but is homozygous for Pde6brd1, which causes retinal degeneration. C3HeB/FeJ inbred mice have been found to be extremely susceptible to virulent Mycobacterium tuberculosis. They develop pulmonary tuberculosis and die within 25-28 days of infection with 105 CFU of Erdman strain of M. tuberculosis (Kramnik et al, 1998). Several QTL have been identified that contribute to the M. tuberculosis susceptibility (Sissons et al., 2009)
acrc:21000486	C9-500	FVB/NJ-Tg(C9orf72)500Lpwr/JNcbs [C9-500 also named as C9orf72-ALS]	Public	Live	Mus Musculus	Coisogenic, Transgenic	JAX -> NCBS	JAX# 029099						Thursday, April 15, 2021	2 males	JAX
acrc:21000063	CamK2	B6.Cg-Tg(Camk2a-cre)T29-1Stl/JNcbs	Public	Live, Cryo-S	Mus Musculus	Congenic, Transgenic	JAX -> JNcbs	JAX# 005359		inbred (sibling X sibling) (f)CamK2 X (m)CamK2	black	litter size 5-10 pups	N		2 duos	Global JAX/NCBS/Instem transfer agreements_2017, USB	New stocks arrived on 9th August 2022.
acrc:21000202	CamK2-Cre, E2-2f/f	B6.Cg-Tg(Camk2a-cre)T29-1Stl/J, E2-2f/f	Public	Live	Mus Musculus	multigenic/compound	JAX and Dan Holmberg (Sweden)	components of JAX# 005359 and MGI:3798811	mixed
acrc:21000128	CaMK2a-CreERT2 [MxP]	B6;129S6-Tg(Camk2a-cre/ERT2)1Aibs/JNcbs	Public	Cryo-S	Mus Musculus	Transgenic (Inducible, Recombinase-expressing)	cryo stocks from MPI (Dresden)-> NCBS	JAX# 012362	B6	Hemizygote x Noncarrier						JAX	cryo stocks from MCI (Ronald - Dresden)-- The CaMK2a-CreERT2 allele was imported from two separate sources (NY and Dresden-MPI). This stock carries the MaxPlank CaMK2a-CreERT2 allele.
acrc:21000560	CaMK2a-CreERT2 [MxP], E2-2f, TRAP	B6;129S6-Tg(Camk2a-cre/ERT2)1Aibs [MxP], Tcf4tm1.1Hmb; B6.129S4Gt(ROSA)26Sor<tm1(CAGEGFP/Rpl10a birA)Wtp>/JNcbs -[R26fsTRAP]	Public	Live, Cryo-S	Mus Musculus		JAX and Dan Holmberg (Sweden)	components of JAX# 012362 and MGI:3798811+ JAX#22367	mixed							JAX, Dan Holmberg (Sweden)	The CaMK2a-CreERT2 allele was imported from two separate sources (NY and Dresden-MPI). This stock carries the MaxPlank CaMK2a-CreERT2 allele.
acrc:21000569	CaMK2a-CreERT2 [MxP], E2-2f/f, RCE	B6;129S6-Tg(Camk2a-cre/ERT2)1Aibs [MxP], E2-2f [Tcf4tm1.1Hmb], Gt(ROSA)26Sortm1.2(CAG-EGFP)Fsh [RCE:FRT] /Ncbs	Public	Live, Cryo-S	Mus Musculus		JAX and Dan Holmberg (Sweden) and Gordon Fishell (NY)	components of JAX# 012362 and MGI:3798811+ JAX#32038 (or MGI:4420764)								JAX, Dan Holmberg (Sweden)	The CaMK2a-CreERT2 allele was imported from two separate sources (NY and Dresden-MPI). This stock carries the Max Plank (MxP) CaMK2a-CreERT2 allele.
acrc:21000562	CaMK2a-CreERT2 [MxP], E2-2f/f, tdTAi9	B6;129S6-Tg(Camk2a-cre/ERT2)1Aibs [MxP], E2-2f [Tcf4tm1.1Hmb], B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J [Ai9(RCL-tdT)] /Ncbs	Public	Live	Mus Musculus		JAX and Dan Holmberg (Sweden)	components of JAX# 012362, MGI:3798811 and JAX#007909	mixed							JAX, Dan Holmberg (Sweden)	The CaMK2a-CreERT2 allele was imported from two separate sources (NY and Dresden-MPI). This stock carries the MaxPlank CaMK2a-CreERT2 allele.
acrc:21000559	CaMK2a-CreERT2 [NY], E2-2f/f, RCE	B6;129S6-Tg(Camk2a-cre/ERT2)1Aibs [NY], E2-2f [Tcf4tm1.1Hmb], Gt(ROSA)26Sortm1.2(CAG-EGFP)Fsh [RCE:FRT] /Ncbs	Public	Live, Cryo-S	Mus Musculus		JAX and Dan Holmberg (Sweden) and Gordon Fishell (NY)	components of JAX# 012362 and MGI:3798811+ JAX#32038 (or MGI:4420764)	mixed							JAX, Dan Holmberg (Sweden)	The CaMK2a-CreERT2 allele was imported from two separate sources (NY and Dresden-MPI). This stock carries the NY CaMK2a-CreERT2 allele.
acrc:21000561	CaMK2a-CreERT2 [NY], E2-2f/f, tdTAi9	B6;129S6-Tg(Camk2a-cre/ERT2)1Aibs [NY], E2-2f [Tcf4tm1.1Hmb], B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J [Ai9(RCL-tdT)] /Ncbs	Public	Live	Mus Musculus		JAX and Dan Holmberg (Sweden)	components of JAX# 012362, MGI:3798811 and JAX#007909	mixed							JAX, Dan Holmberg (Sweden)	The CaMK2a-CreERT2 allele was imported from two separate sources (NY and Dresden-MPI). This stock carries the NY CaMK2a-CreERT2 allele.
acrc:21000223	CaMK2a-CreERT2 [NY], E2-2f/f, Thy1-GFP lineM;R26-Stop-fl-Ai9-tdTomato	B6;129S6-Tg(Camk2a-cre/ERT2)1Aibs/JNcbs [NY], Tcf4tm1.1Hmb (E2-2-)/Ncbs, STOCK Tg(Thy1-EGFP)MJrs/JNcbs [Thy1-GFP line M];B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/JNcbs [Ai9(RCL-tdT)]	Public	Live, Cryo-S	Mus Musculus	compound	JAX and Dan Holmberg (Sweden)	components of JAX# 012362 and MGI:3798811 and JAX#007788	mixed							Global JAX/NCBS/Instem transfer agreements_2017, Dan Holmberg (Sweden)	The Thy1-EGFP allele was recovered from IISC stocks- most likely: STOCK Tg(Thy1-EGFP)MJrs/J [Thy1-GFP line M]-- The CaMK2a-CreERT2 allele was imported from two separate sources (NY and Dresden-MPI). This stock carries the NY CaMK2a-CreERT2 allele.
acrc:21000470	CaMK2a-CreERT2, E2-2, RCE	B6;129S6-Tg(Camk2a-cre/ERT2)1Aibs, E2-2f [Tcf4tm1.1Hmb], Gt(ROSA)26Sortm1.2(CAG-EGFP)Fsh [RCE:FRT] /Ncbs	Public	Cryo-S	Mus Musculus		JAX and Dan Holmberg (Sweden) and Gordon Fishell (NY)	components of JAX# 012362 and MGI:3798811+ JAX#32038 (or MGI:4420764)	mixed							JAX, Dan Holmberg (Sweden)
acrc:21000090	Cas9 (Rosa26)	STOCK Gt(ROSA)26Sortm1.1(CAG-cas9*,-EGFP)Fezh/JNcbs (constitutive Rosa26-Cas9 knockin)	Public	Cryo-S	Mus Musculus	KI -Targeted (Inserted expressed sequence, Reporter)	JAX	JAX# 024858	mixed (B6N , 129 , B6J and maybe FVB/N)	Homozygote x Homozygote OR Homozygote x Inbred and recip	black		Y	Thursday, January 14, 2016	2 breeding pairs (homozygotes littermates DOB- 29 Dec 2015)	Global JAX/NCBS/Instem transfer agreements_2017	_______________________________________________________________________ MGEF- need to backcross on B6/J JAX<The construct was electroporated into 129-derived R1 embryonic stem (ES) cells. Correctly targeted ES cells were injected into C57BL6/N blastocysts. The resulting chimeric animals were tested for germline transmission by crossing to C57BL/6N mice. The mice were then crossed to a beta-actin driven Cre recombinase strain (FVB/N) (Stock No. 003376) to excise the floxed STOP cassette. Upon arrival at The Jackson Laboratory, the mice were crossed to C57BL/6J (Stock No. 000664) at least once to establish the colony.>
acrc:21000192	Casp1-/-	B6N.129S2-Casp1tm1Flv/JNcbs [ICE]	Public	Live, Cryo-S	Mus Musculus		JAX-> JamoraLab-> ACRC	JAX#016621								JAX	CJ-- This strain, relevant to studies of inflammation and cell death, carries a knockout allele of the Casp1 gene as well as an incidental Casp4 deficiency.
acrc:21000139	Casp8 fl/fl	Casp8tm1Hed/Ncbs [floxed exon 3]	Public	Live	Mus Musculus	Targeted (Conditional ready, No functional change)	Stephen Hedrick, at UCSD	MGI:3696985 ; Stock also available at JAX as JAX#027002								Stephen Hedrick, at UCSD, Colin Jamora	CJ https://doi.org/10.4049/jimmunol.175.6.3469 Stock also available at JAX as JAX#027002
acrc:21000017	Casp8 fl/fl, K14Cre	Casp8tm1Hed/Ncbs [floxed exon 3], Tg(KRT14-cre)1Efu/Ncbs (C57B6)	Public	Live	Mus Musculus		Stephen Hedrick, at UCSD ; Elaine Fuchs at Rockefeller University	compund of MGI:3696985 & MGI:1926500		heterozygote breeding	black		Y			Stephen Hedrick, at UCSD, Elaine Fuchs at Rockefeller University, Colin Jamora	CJ
acrc:21000025	Casp8 fl/fl, K14Cre, Casp1-/-	Casp8tm1Hed/Ncbs [floxed exon 3], Tg(KRT14-cre)1Efu/Ncbs (C57B6), B6N.129S2-Casp1tm1Flv/JNcbs [ICE]	Public	Live	Mus Musculus	congenic	Jamora Lab	compound of JAX#016621 , MGI:3696985 , MGI:1926500		heterozygote X homozygote	Black		Yes			JAX, Colin Jamora, Stephen Hedrick, at UCSD, Elaine Fuchs at Rockefeller University	CJ
acrc:21000018	Casp8 fl/fl, K14Cre, gdTCR KO	caspase 8 fl/fl, K14Cre (C57B6), gdTCR-/-	Public	Live	Mus Musculus	coisogenic	Jamora Lab			heterozygote breeding	black		Yes				CJ
acrc:21000166	Casp8fl/fl,K14Cre,IL1r1-/-	caspase 8 fl/fl, K14-Cre (C57B6), IL-1R^-/- (B6.129S7-Il1r1tm1Imx/J) interleukin 1 receptor, type I	Public	Live	Mus Musculus			components of JAX# 003245									CJ
acrc:21000234	CBA/J_2017	CBA/JNcbs [2017]	Public	Live, Cryo-E, Cryo-S	Mus Musculus		JAX	JAX#000656		inbred	agouti	This strain is homozygous for the retinal degeneration allele Pde6b-rd1, which causes blindness by wean age.		Wednesday, September 13, 2017	2 breeding pairs	JAX	JAX notes: CBA/J strain carries the Pde6brd1 mutation, which causes blindness by wean age. Renal tubulointerstitial lesions have been observed in this strain at a high frequency. Some CBA/J mice spontaneously develop exocrine pancreatic insufficiency syndrome.
acrc:21000505	CBA_2021	CBA/JNcbs [2021]	Public	Live, Cryo-E, Cryo-S	Mus Musculus		JAX	JAX#000656						Thursday, June 24, 2021	2 breeding pairs	JAX
acrc:21000110	CBF:H2B-Venus [2018]	STOCK Tg(Cp-HIST1H2BB/Venus)47Hadj/JNcbs	Public	Cryo-S	Mus Musculus	Transgenic	JAX ->NCBS	JAX# 020942	originally generated on FVB	Hemizygote x Noncarrier or Noncarrier x Hemizygote	albino			Thursday, September 20, 2018	1 breeding pair (Hemizygoytes)	JAX
acrc:23000030	Ccdc11(Cfap53)	Ccdc11(Cfap53)-[RIKEN]	Public	Cryo-S	Mus Musculus	Ccdc11(Cfap53)	RIKEN (CDB0210E)							Monday, April 3, 2023	Imported 2 straws of Sperms
acrc:21000070	CD1	Crl:CD1(ICR)/Ncbs	Public	Live	Mus Musculus	WT	Crl	Crl#022		OUTBRED	white albino				= old stock imported in 2013 or prior - Filiation unknown	Crl	= old stock imported in 2013 or prior - Filiation unknown Crl Health monitoring does not include Proteus mirabilis testing. some Crl CD1 mice have been tested positive for Proteus mirabilis in NCBS colonies. These were NOT initially imported as ELITE stocks from Crl !!!??
acrc:21000353	CD1-2019	Crl: CD1 (IGS) Elite	Public	Live, Cryo-E, Cryo-S	Mus Musculus		Charles River USA	Crl:022 - Elite SPF		mini Outbred	albino			Thursday, May 30, 2019	5 breeding pairs from Crl USA via Hyalasco	Crl USA
acrc:21000393	CD45.2 ; Ly5.2	CD45.2 ; Ly5.2	Public	Cryo-S	Mus Musculus		JNCASR - MI -> initially imported from NII, Delhi - Dr. Asok Mukhopadhyay-(retired)	?? to be checked and verified								??, Maneesha Inamdar (JNCSAR)	Stock Cryopreserved for Maneesha Inamdar (JNCSAR) but initially imported to JNCSAR from from NII, Delhi - Dr. Asok Mukhopadhyay (retired)-
acrc:21000289	CD4Cre, FoxP3YFP-cre, RaploxP	CD4Cre, FoxP3YFP-cre, RaploxP	Public	Live	Mus Musculus	compound	JAX and Freddy Radtke (EPFL) for the CD4 allele	Components of JAX#016959 and JAX# 013188 and CD4Cre	mixed							JAX + Freddy Radtke (EPFL) for the CD4 allele
acrc:21000010	CD4Cre, Notch-4-loxP	CD4Cre, Notch4lox/lox	Public	Live	Mus Musculus	Targeted KO	Freddy Radtke (EPFL) - CD4 allele; and ?		B6		black					ACRC	AS
acrc:21000005	CD4Cre, Notch1loxP	CD4Cre, Notch1lox/lox	Public	Live, Cryo-S	Mus Musculus	Tg, Targeted KO	Freddy Radtke EPFL		B6	Notch1lox/lox (F) X CD4Cre+, Notch1lox/lox (M)	black		Y			Freddy Radtke EPFL	AS
acrc:21000007	CD4Cre, RaploxP	CD4Cre, Raptor lox/lox	Public	Live, Cryo-S	Mus Musculus	Targeted KO	JAX and Freddy Radtke (EPFL) for the CD4 allele	components of JAX#013188 and ?	B6	Raptor lox/lox (F) X CD4Cre +ve, Raptor lox/lox (M)	black		Y				AS
acrc:21000529	Cdh5CreER; Gpr177Fx	Tg(Cdh5-cre/ERT2)1Rha/Ncbs [Cadherin5CreER]; Wlstm1.1Whsu/JNcbs [Gpr177Fx]	Public	Live	Mus Musculus	Compound	Cdh5CreER;Red-Horse Lab - Stanford University, Gpr177Fx - JAX	Cdh5CreER- MGI:3848982, Gpr177Fx- JAX#027484	Mixed					Saturday, February 13, 2021		Red-Horse Lab - Stanford University, Cadherin5CreER from Ralf H Adams (Max Planck Institute for Molecular Biomedicine, University of Münster, Germany), Gpr177Fx- JAX	Cadherin5CreER - imported by Soumyashree Das from Stanford University- Cadherin5CreER allele originally from Ralf H Adams (Max Planck Institute for Molecular Biomedicine, University of Münster, Germany). Gpr177Fx- for SD lab (Jax Cryorecovery services)
acrc:21000069	CF1	Crl:CF1	Public	Live	Mus Musculus	WT	Crl	Crl# 023		OUTBRED	white albino				= old stock imported in 2013 or prior? - Filiation unknown	Crl	AF - Old Stock - most likely no longer outbred- NOT imported as ELITE stocks from Crl.
acrc:21000352	CF1_2019	Crl:CF1 - SPF	Public	Live, Cryo-S	Mus Musculus		Charles River USA	Crl:023		mini outbred	albino			Thursday, May 30, 2019	5 breeding pairs from Crl USA via Hyalasco	Crl USA
acrc:21000333	CMV-cre_TIFRm	B6.C-Tg(CMV-cre)1Cgn	Public	Cryo-S	Mus Musculus	Transgene overexpression	Cryo for Ullas Kolthur - TIFRmumbai - JAX	JAX#006054	C57BL6/J					Thursday, November 3, 2016		Ullas Kolthur for CryoStocks, JAX	JAX: The transgene appears to be X-linked since transgene transmission through males is restricted to female offspring.
acrc:21000129	CMVCre	B6.C-Tg(CMV-cre)1Cgn/JNcbs	Public	Live, Cryo-S	Mus Musculus	Congenic, Transgenic (Recombinase-expressing)	JAX	JAX# 006054		Homozygote x Hemizygote (Transgene appears to be X-linked)	black		Y		4 males + 4 females (26-Feb-2009)	Global JAX/NCBS/Instem transfer agreements_2017	Stock Cryopreserved for Maneesha Inamdar (JNCSAR). - JAX: The transgene appears to be X-linked since transgene transmission through males is restricted to female offspring.
acrc:21000297	Cor1a	B6.129-Coro1Atm1Jpie/JNcbs	Public	Live, Cryo-S	Mus Musculus	congenic ; Targeted Mutation (Reporter, Null/Knockout)	JAX ->NCBS	JAX# 030203	B6	Homo X Homo or Homo X Het	black	Cor1-/- mice lack naive T cells in the periphery		Thursday, September 20, 2018	1 Breeding pair (homozygous nul)	Global JAX/NCBS/Instem transfer agreements_2017	Cor1-/- mice lack naive T cells in the periphery and show cognitive and behavioral disfunction. EGFP immunofluorescence is observed by direct visualization in these mice.
acrc:21000437	Csf1r Flox	B6.Cg-Csf1rtm1.2Jwp	Public	Live	Mus Musculus		Imported from IISC - originally a JAX stock	JAX#021212	B6					Wednesday, November 18, 2020		JAX relocation MTA	3 males imported from IISC [Narendrakumar Ramanan] - rederived at MGEF- for SR lab.
acrc:21000130	Cx3cr1CreER	B6.129P2(Cg)-Cx3cr1tm2.1(cre/ERT)Litt/WganJNcbs	Public	Live	Mus Musculus	Congenic, Targeted Mutation	JAX	JAX# 021160		Homozygote x Homozygote						Global JAX/NCBS/Instem transfer agreements_2017	HSG
acrc:22000016	Cx3cr1CreER; Csf1r Flox	B6.129P2(Cg)-Cx3cr1tm2.1(cre/ERT)Litt/WganJNcbs; B6.Cg-Csf1rtm1.2Jwp	Public	Live	Mus Musculus	Compound	JAX -> NCBS	Cx3cr1CreER- JAX# 021160, Csf1r Flox- JAX#021212								JAX
acrc:22000026	Cx40CreER, tdTAi9 [Mixed]; Cdk1-L	Cx40CreER, B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze [Ai9]; 129S(B6N)-Cdk1tm1Eddy/JNcbs	Public	Live	Mus Musculus	Compound	Cx40CreER, tdTAi9 [Mixed]- Red-Horse Lab - Stanford University and Ai9 allele originally from JAX#007909 , Cdk1-L- JAX	Cx40CreER, tdTAi9 [Mixed] -Red-Horse Lab - Stanford University and Ai9 allele originally from JAX#007909, Cdk1-L - JAX # 028028
acrc:22000011	Cx40CreER, tdTAi9 [Mixed]; Gpr177Fx	Cx40CreER, B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze [Ai9]; Wlstm1.1Whsu/JNcbs [Gpr177Fx]	Public	Live	Mus Musculus	Compound	Red-Horse Lab - Stanford University and JAX	Ai9 allele originally from JAX#007909, Gpr177Fx- JAX#027484								Red-Horse Lab - Stanford University, JAX
acrc:21000527	Cx40CreER; Cx40eGFP; tdTAi9 [Mixed]	Cx40CreER, Cx40eGFP, B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze [Ai9]/JNcbs	Public	Live	Mus Musculus	Compound	Red-Horse Lab - Stanford University	Ai9 allele originally from JAX#007909	Mixed - B6J and Balb/C					Tuesday, December 15, 2020		Cx40CreER allele originally from Lucile Miquerol (Aix-Marseille Université, CNRS UMR 7288, IBDM, Marseille, France.), JAX, , Cx40eGFP allele -Lucile Miquerol (Aix-Marseille Université, CNRS UMR 7288, IBDM, Marseille, France.), Red-Horse Lab - Stanford University	Imported By Soumyashree Das from Standford University. Cx40CreER and Cx40eGFP alleles originally from Lucile Miquerol (Aix-Marseille Université, CNRS UMR 7288, IBDM, Marseille, France.)
acrc:21000488	Cxcr4flox	B6.129P2-Cxcr4tm2Yzo/JNcbs	Public	Live	Mus Musculus	Congenic, Targeted Mutation	JAX -> NCBS	JAX# 008767						Thursday, April 15, 2021	2 breeding pairs	JAX
acrc:21000454	Dach1-flox	Dach1-flox	Public	Cryo-S	Mus Musculus		Kristy Red-Horse, Stanford University	originally from KOMP repository	mixed (FVBN , CD1) ??? to double check - because animals are black		black			Tuesday, December 15, 2020	2 females	Red-Horse Lab - Stanford University, KOMP	imported by Soumyashree Das from Standford University.
acrc:21000032	db (B6)	B6.BKS(D)-Leprdb/J , db/db (Leprdb -Leptin Receptor Mutant)	Public	Live	Mus Musculus	Congenic Spontaneous Mutation	JAX	JAX# 000697			Black/Black		Yes			Global JAX/NCBS/Instem transfer agreements_2017	CJ
acrc:21000237	db/+_2018	BKS.CgDock7< m> +/+ Lepr<db>/J Ncbs	Public	Live, Cryo-E, Cryo-S	Mus Musculus	Diabetic model - double mutant - spontaneous mutations	JAX	JAX#000642	BKS	Het X Het (db phenotype is background specific)		Leprdb= black, fat; Related Genotype: a/a + Leprdb/+ Leprdb ; Dock7m Leprdb= black, lean; Related Genotype: a/a Dock7m +/+ Leprdb; Dock7m= misty (grey), lean; Related Genotype: a/a Dock7m +/Dock7m +		Wednesday, February 21, 2018	1 breeding pair - Male died before breeding! + 2 new breeding pairs in Feb2018	Global JAX/NCBS/Instem transfer agreements_2017	September 2017: 1 breeding pair was imported and quarantined. when setting up mating after quarantine- a small protrusion was observed in the sternum region- the Male died with severe Ascites phenotype a few days later- Female is fine. 2 New Breeding pairs (2M+2F) imported in Feb2018.
acrc:21000487	DBA1	DBA/1JNcbs	Public	Live, Cryo-E, Cryo-S	Mus Musculus	inbred	JAX -> NCBS	JAX# 000670						Thursday, April 15, 2021	2 breeding pairs	JAX	DBA/1J mice are widely used as a model for rheumatoid arthritis: immunization with type II collagen leads to the development of severe polyarthritis mediated by an autoimmune response. DBA/1J mice show an intermediate susceptibility to developing atherosclerotic aortic lesions on an atherogenic diet. In response to challenge, DBA/1J mice develop immune-mediated nephritis characterized by proteinuria, glomerulonephritis and tubulointerstitial disease.
acrc:21000067	DBA2	DBA/2JNcbs	Public	Cryo-S	Mus Musculus	WT	JAX	JAX# 000671		inbred (sibling X sibling)	dilute brown				= old stock imported in 2013 or prior - Filiation unknown		= old stock imported in 2013 or prior - Filiation unknown JAX: DBA/2J is a widely used inbred strain. Some characteristics include low susceptibility to developing atherosclerotic aortic lesions, high-frequency hearing loss, susceptibility to audiogenic seizures, development of progressive eye abnormalities that closely mimic human hereditary glaucoma, and extreme intolerance to alcohol and morphine.
acrc:21000256	DBA2_2018	DBA/2JNcbs [2018]	Public	Live, Cryo-S	Mus Musculus	WT	JAX	JAX# 000671		inbred (sibling X sibling)	dilute brown	hearing loss	NO	Wednesday, February 21, 2018	3 breeding pairs	Global JAX/NCBS/Instem transfer agreements_2017	@JAX -DBA/2J is a widely used inbred strain. Some characteristics include low susceptibility to developing atherosclerotic aortic lesions, high-frequency hearing loss, susceptibility to audiogenic seizures, development of progressive eye abnormalities that closely mimic human hereditary glaucoma, and extreme intolerance to alcohol and morphine.
acrc:21000506	DBA2_2021	DBA/2JNcbs [2021]	Public	Live, Cryo-E, Cryo-S	Mus Musculus		JAX	JAX# 000671						Thursday, June 24, 2021	4 breeding pairs	JAX
acrc:21000525	DCX CreERT2; E2-2f; R26fsTRAP	Dcx_CreERT2-UTR_TG_04; Tcf4tm1.1Hmb; B6.129S4Gt(ROSA)26Sor<tm1(CAGEGFP/Rpl10a birA)Wtp>/JNcbs -[R26fsTRAP]	Public	Cryo-S	Mus Musculus	compound	DCXallele from Wolfgang Wurst; JAX and Dan Holmberg (Sweden)	JAX# 22367; MGI:3798811								E2-2 = Dan Holmberg (Sweden), R26fsTRAP = JAX, CryoStock = HSG, DCXCre from Prof. Wolfgang Wurst / German Research Center for Environmental Health	REF for DCXCreER Allele: BMC Neurosci. 11:158. doi: 10.1186/1471-2202- 11-158
acrc:23000029	Dtd1 and Dtd2	Dtd1 and Dtd2[RIKEN]	Public	Cryo-E, Cryo-S	Mus Musculus		RIKEN (CDB0297E &CDB0298E)		C57BL/6N*+/-					Monday, April 3, 2023	Imported 3 vials of embryos and 4 straws of Sperms		Embryo Vial Ids: R175,R176 AND R177 received at 2 cell stage
acrc:21000142	EmtbGFP	K14-EmtbGFP (keratinocytes)	Public		Mus Musculus											ACRC	CJ
acrc:21000164	EmtbGFP,K14CreER,Casp8fl	K14-EmtbGFP, K14 CreER+ (C57B6) ?, Caspase-8 fl/fl	Public	Live, Cryo-S	Mus Musculus		Jamora Lab										CJ
acrc:22000050	Emx CreKJ/KJ; Ai9/+	Emx1tm1(cre)Krj/Ncbs; B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/JNcbs	Public	Live, Cryo-S	Mus Musculus	Compound	Shubha Tole (TIFRmumbai), JAX	Ai9 allele originally from JAX#007909, MGI:2684610 - Emx1CreKJ allele also available as JAX#005628,	MIXED	Homozygote x Homozygote						JAX	Shubha Tole (TIFRmumbai), JAX
acrc:21000320	Emx1 CreYL/+, TCA/+, Lhx2cKO/cKO	Emx1tm1(cre)Yql; TCA-GFP (5-HTT -GFP); Lhx2tm1Monu	Public	Cryo-S	Mus Musculus	compound	cryo for Shubha Tole (TIFR Mumbai)	PMID:10772936 ; MGI:2176219, PMID: 24685175 ; MGI:3772179						Thursday, January 26, 2017		Shubha Tole (TIFRmumbai) for Cryo Stocks, Emx1CreYL from Yuqing Li, Department of Neurology, University of Florida, TCA-GFP from Takuji Iwasato, Division of Neurogenetics, National Institute of Genetics, Mishima 411-8540, Japan	Emx1CreYL = Cre recombinase inserted directly into the exon 1 of the Emx1 gene (PMID:10772936). Emx1creYLF : CCCGATATCATTTACGCGTTAATG ; Emx1creYLR: CACTCATGGAAAATAGCGATC -> 618bp. - TCA-GFP= Reporter mice expressing the membrane-bound enhanced GFP from the sensory thalamus-specific serotonin transporter (5-HTT) promoter PMID: 24685175. primers: TCA-GFP-F: ATGCTGTGCTGTATGAGAAGAACCA ; TCA-GFP-R: TTCTCGTTGGGGTCTTTGCT -> 800 bp.
acrc:21000323	Emx1Cre KJ/KJ; Lhx2sKO/+	Emx1tm1(cre)Krj [Emx1IRES cre]; Lhx2tm1Dra (=Lh2sKO, Lhx -)	Public	Cryo-S	Mus Musculus	compound	cryo for Shubha Tole (TIFR Mumbai)	MGI:2684610 + MGI:1890208 / Emx1CreKJ allele also available as JAX#005628	mixed			Lhx2sKO homozygotes are embryonic lethal (E15.5)		Thursday, February 9, 2017		Shubha Tole (TIFRmumbai) for Cryo Stocks, JAX
acrc:21000474	Emx1CreKJ	Emx1tm1(cre)Krj/Ncbs	Public	Live	Mus Musculus		shubha Tole - TIFR Mumbai	MGI:2684610 - Emx1CreKJ allele also available as JAX#005628						Saturday, March 6, 2021		Shubha Tole (TIFRmumbai), JAX	BM imported from TIFRmumbai
acrc:21000317	Emx1CreKJ/+, Ldb1cKO/cKO, Ldb2sKO/+	Emx1tm1(cre)Krj ; Ldb1 cKO ; Ldb2 sKO-null	Public	Cryo-S	Mus Musculus	compound	cryo for Shubha Tole (TIFR Mumbai)	PMID:12151506 ; MGI:2684610 + PMID:17664423 - Emx1CreKJ allele also available as JAX#005628	mixed					Friday, January 27, 2017		Shubha Tole (TIFRmumbai) for Cryo Stocks, Susan McConell for Ldb1cKO & Ldb2sKO, JAX	Ldb1 G: cttatgtgaccacagccatgcatgcatgtg ; Ldb1-sense: cagcaaacggaggaaacggaagatgtcag -> Ldb1WT: 250bp; Ldb1Mut: 400bp. Ldb2_neo5 5’-CTGTGCTCGACGTTGTCACTG-3’ ; Ldb2_neo3 5’-GATCCCCTCAGAAGAACTCGT-3’; Ldb2_F2 5’-CAGACTGCTCATCACACACTTGTTGAT-3’; Ldb2_R2 5’-CTCAAGAAATCCAAGGGGTGTTACTTA-3’ Ldb2MUT- 400bp and Ldb2WT-700bp.
acrc:21000514	Emx1CreYL, Lhx2cKO, Ai9	Emx1tm1(cre)Yql/Ncbs, Lhx2tm1Monu/Ncbs, B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/JNcbs	Public	Live	Mus Musculus	compound	rederived from Shubha Tole Stocks- TIFR Mumbai	compound of MGI:2176219, MGI:3772179, JAX#007909	mixed							JAX, Shubha Tole - TIFR Mumbai, Emx1CreYL from Yuqing Li, Department of Neurology, University of Florida, BM	BM
acrc:21000472	Emx1CreYL/+; Lhx2cKO/delta	Emx1tm1(cre)Yql/Ncbs; Lhx2cKO/delta [Lhx2tm1Monu] / Ncbs	Public	Live	Mus Musculus	compound	rederived from Shubha Tole Stocks- TIFR Mumbai	compound of MGI:2176219 ; MGI:3772179	mixed					Saturday, March 6, 2021		Emx1CreYL from Yuqing Li, Department of Neurology, University of Florida, Shubha Tole - TIFR Mumbai	BM
acrc:21000304	Emx2-Cre	Emx2-Cre/+ [RIKEN]	Public	Live, Cryo-S	Mus Musculus		RIKEN-CDB	CDB0020K	B6/N ×（-/+）					Thursday, November 22, 2018	1 vial of 2 cell embryos	RIKEN-CDB	sperm QC efficiency:38.7% Control sperm efficiency for current QC session:98.03%
acrc:21000481	Emx2-Cre ; R26R-Mito-EGFP	Emx2-Cre [Riken] ; R26R-Mito-EGFP/MitoG#22(loxP) [Riken]	Public	Live	Mus Musculus	compound	Riken CDB -> Ncbs	compound of Riken-CDB # CDB0020K & CDB0216K								RIKEN CDB
acrc:21000496	Emx2-Cre; tdTomatoAi14	Emx2-Cre [RIKEN] ; B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/JNcbs (tdT)	Public	Live	Mus Musculus		RIKEN + JAX	compound of RIKEN#CDB0020K + JAX# 007914								RIKEN CDB , JAX
acrc:21000318	FezF2+/- ; Lhx2cKO/cKO	Fezf2tm1Hibi ; Lhx2tm1Monu	Public	Cryo-S	Mus Musculus	compound	cryo for Shubha Tole (TIFR Mumbai) + RIKEN	PMID: 16971467; MGI:3772179 ; PMID: 18202285	mixed					Friday, January 27, 2017		Shubha Tole (TIFRmumbai) for Cryo Stocks, Masahiko Hibi -RIKEN	Null allele of Fezf2 [from Masahiko Hibi -RIKEN] gene created by replacing exons containing most of the fezl coding region (amino acids 27-455) with the β-galactosidase and neomycin-resistance genes-
acrc:21000271	Fgfr1 fl/fl	Fgfr1 fl/fl (CD1???)	Public	Live, Cryo-E	Mus Musculus		RIKEN-CDB + Raj Ladher		CD1?? mentione don import file but animals are black?	?				Monday, January 29, 2018	1 CryoVial (= 61 2-cell embryos); 1 cryo vial with vial id: Y876 redeived on 3rd Apr 2023	RIKEN-CDB + Raj Ladher Lab	June 2018- the Initial Cryo-recovered females exhibit imperforated vagina phenotypes at time of weaning-
acrc:21000263	FGFR1delta	FGFR1delta FRS	Public	Live	Mus Musculus		RIKEN-CDB + From Soriano Lab		B6/N	B6/N WT X (+/-)				Monday, January 29, 2018	1 CryoVial (= 57 2-cell embryos)	Phil Soriano
acrc:21000268	Fgfr1floxEx4	Fgfr1floxex4/+ [B6.129S4-Fgfr1tm5.1Sor ??]	Public	Live, Cryo-E	Mus Musculus	Targeted (Conditional ready (e.g. floxed), No functional change)	RIKEN-CDB [initially from JAX]	is this the JAX#007671 ?? please do confirm	B6; 129/sv	129/sv X (+/-) or (+/-) X (+/-)				Monday, January 29, 2018	1 CryoVial (= 40 2-cell embryos); 1 cryoVial with Vial ID: P224 received on 3rd Apr 2023	RIKEN-CDB + JAX
acrc:21000265	Fgfr1n15YF	Fgfr1n15YF	Public	Live, Cryo-E	Mus Musculus					CD-1WT X (+/-)				Monday, January 29, 2018	1 CryoVial (= 60 2-cell embryos)	RIKEN-CDB + Raj Ladher Lab
acrc:21000267	Fgfr2 flox/flox	Fgfr2 flox/flox	Public	Cryo-E	Mus Musculus		RIKEN-CDB + From Partanen Lab							Monday, January 29, 2018	1 CryoVial (= 27 2-cell embryos)	RIKEN-CDB + Partanen Lab
acrc:21000030	Fibulin5 KO	fibulin-5 -/- (C57BL6)	Public	Cryo-S, Discontinued	Mus Musculus					Homozygous breeding	black		Yes				The strain Cryopreserved (sperms) and The live colony is discontinued from March 2024 on request of CJ lab rep and confirmation of PI
acrc:21000031	Fibulin5 KO, K14Snail(B6)	K14CRE Snail Transgenic, fibulin-5 -/- (C57BL6)	Public	Live, Cryo-S	Mus Musculus	Transgenic	Jamora Lab			K14Snail(B6) X Fibulin5 KO	Black		Yes				CJ
acrc:21000158	Fmr1tm1Cgr	fragile X mental retardation syndrome 1 (= Fmr1 KO)	Public	Live, Cryo-S	Mus Musculus	Targeted (Null/knockout)	David Nelson, Baylor	MGI:1857169	backcrossed on B6 since arrived at NCBS	outbred every third generation	black	average litter size of 6-8 pups after the 2nd litter. Almost systematic cannibalism of the first litter and frequent cannibalism of subsequent litters - Around 50% male /female ratio in litters	Y			ACRC	AB, SC
acrc:21000039	FosCreERT2	B6.129(Cg)-Fostm1.1(cre/ERT2)Luo/JNcbs	Public	Cryo-S	Mus Musculus	Congenic, Targeted Mutation (Inducible, Recombinase-expressing)	JAX -> JNcbs	JAX# 21882	C57BL/6J	+/+ sibling x Heterozygote OR Heterozygote x C57BL/6J (WT)	black	6-9 pups per litter	Yes	Tuesday, July 14, 2015	2 het males	Global JAX/NCBS/Instem transfer agreements_2017	FosCreERT2 strain should NOT be maintained as Homozygotes, since deletion of Fos leads to abnormalities in growth and behavior of the mice as well as growth defects, osteopetrosis, perinatal death [partial penetrance] and abnormalities in tooth eruption, gametogenesis, hemopoiesis, and photoreceptor apoptosis are expected. [old stock ID=acrc:00010]
acrc:21000526	Foxg1-cre [B6J]	Foxg1-cre 129(Cg)-Foxg1tm1(cre)Skm/JNcbs XB6JNcbs	Public	Live	Mus Musculus	Compound	RIKEN-CDB + From Jackson, 花嶋先生 lab - JAX#004337		B6J					Monday, January 29, 2018		RIKEN-CDB + 花嶋先生 lab; , JAX
acrc:23000073	Foxg1-cre [B6J]; betaCat-Flox	Foxg1-cre 129(Cg)-Foxg1tm1(cre)Skm/JNcbs XB6JNcbs; B6.129-Ctnnb1tm2Kem/Ncbs (beta-Catenin cKO)	Public	Live	Mus Musculus	Compound	RIKEN-CDB + From Jackson, 花嶋先生 lab - JAX#004337; Rolf Kemler, MPI-IE Freiburg (NCBS imported via Shubha Tole-TIFR Mumbai)	JAX#004337; MGI:2148567 also available as JAX: 004152	Mixed		White, Black coat colour						RL lab
acrc:23000072	Foxg1-cre [B6J]; betaCat-loxEx3	Foxg1-cre 129(Cg)-Foxg1tm1(cre)Skm/JNcbs XB6JNcbs; Ctnn1b tm1Mmt (beta-Catenin GOF)	Public	Live	Mus Musculus	Compound	RIKEN-CDB + From Jackson, 花嶋先生 lab - JAX#004337; Makoto Mark Taketo, Kyoto University (NCBS imported via Shubha Tole-TIFR Mumbai)	JAX#004337; MGI:1858008	Mixed		White, Black coat colour						RL lab
acrc:23000074	Foxg1-cre [B6J]; Notch1 Flox	Foxg1-cre 129(Cg)-Foxg1tm1(cre)Skm/JNcbs XB6JNcbs; Notch1 Flox	Public	Live	Mus Musculus	Compound	RIKEN-CDB + From Jackson, 花嶋先生 lab - JAX#004337; Freddy Radtke EPFL	JAX#004337; ---	B6		black coat color						RL lab
acrc:21000534	Foxg1-cre [B6J]; tdTomatoAi14	Foxg1-cre 129(Cg)-Foxg1tm1(cre)Skm/JNcbs XB6JNcbs; B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/JNcbs (tdT or tdTAi14)	Public	Live	Mus Musculus	Compound	Foxg1-cre [B6J]- RIKEN-CDB + From Jackson, 花嶋先生 lab - JAX#004337; tdTomatoAi14-JAX# 007914	Foxg1-cre [B6J]- RIKEN-CDB + From Jackson, 花嶋先生 lab - JAX#004337; tdTomatoAi14-JAX# 007914	B6J							RIKEN-CDB + 花嶋先生 lab; JAX
acrc:21000266	Foxg1-cre [B6NJ]	Foxg1-cre 129(Cg)-Foxg1tm1(cre)Skm/JNcbs XB6N	Public	Live, Cryo-S	Mus Musculus	Targeted (Recombinase-expressing, Null/Knockout)	RIKEN-CDB + From Jackson, 花嶋先生 lab - JAX#004337	JAX#004337	received embryos from RIKEN as mixed B6/N ; 129SV	RIKEN: ♀B6/N WT×♂Foxg1-cre		Mutant homozygous lethal		Monday, January 29, 2018	1 CryoVial (= 60 2-cell embryos) -> cryorecovered	RIKEN-CDB + 花嶋先生 lab; , JAX	from Jax: https://www.jax.org/strain/004337 - "Mice that are homozygous for the targeted mutation die perinatally. The authors also note that in general, the frequency of recombination in Cre;floxed double mutant germline cells appears to be considerably higher than in zygotes produced by breeding Cre mice to floxed mice. This reports that Foxg1-Cre;floxed double mutant males bred to witdtype females produced some offspring with germline deletion of the floxed allele [68.8% (11/16)]. Female germline expression was not determined. As such, for Cre-lox experiments and to avoid/minimize germline deletion of the floxed allele, researchers may consider breeding Foxg1-Cre females to floxed males."
acrc:21000535	Foxg1-cre [B6NJ]; tdTomatoAi14	Foxg1-cre 129(Cg)-Foxg1tm1(cre)Skm/JNcbs XB6NJNcbs; B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/JNcbs (tdT or tdTAi14)	Public	Live	Mus Musculus	Compound	Foxg1-cre [B6NJ]- RIKEN-CDB + From Jackson, 花嶋先生 lab ; tdTomatoAi14- JAX	Foxg1-cre [B6NJ]- RIKEN-CDB + From Jackson, 花嶋先生 lab - JAX#004337; tdTomatoAi14- JAX# 007914	B6NJ and B6J							RIKEN-CDB + 花嶋先生 lab; , JAX
acrc:21000316	Foxg1cKO/+; RCEfrt/frt; Lhx2cKO/cKO; Pax6cKO/cKO	Foxg1tm1Fsh ; Gt(ROSA)26Sortm1.2(CAG-EGFP)Fsh [RCE:FRT] ; Lhx2tm1Monu ; Pax6tm1Ued (=Pax6LoxP)	Public	Cryo-S	Mus Musculus	compound	cryo for Shubha Tole (TIFR Mumbai) + JAX	Foxg1= PMID: 22726835 ;RCEfrt=[MMRRC Stock No: 32038-JAX (=oldJAX#10812?)]; MGI:3772179 + Pax6cKO=MGI:4354122	mixed					Wednesday, January 25, 2017		Shubha Tole (TIFRmumbai) for Cryo Stocks, JAX, Foxg1: Gordon Fishell, NYU Neuroscience Institute
acrc:21000314	Foxg1cKO/cKO; RCEfrt/frt; Lhx2cKO/cKO	Foxg1tm1Fsh ; Gt(ROSA)26Sortm1.2(CAG-EGFP)Fsh [RCE:FRT] ; Lhx2tm1Monu	Public	Cryo-S	Mus Musculus		cryo for Shubha Tole (TIFR Mumbai) + JAX	Foxg1= PMID: 22726835 ;RCEfrt=[MMRRC Stock No: 32038-JAX (=oldJAX#10812?)]; MGI:3772179	mixed					Friday, November 25, 2016		Foxg1: Gordon Fishell, NYU Neuroscience Institute, Shubha Tole (TIFRmumbai) for cryo stock, JAX
acrc:21000517	FOXJ1-Cre [H], BetaCat cKO	Tg(FOXJ1-cre)Htzm [Holtzman Cre], B6.129-Ctnnb1tm2Kem/Ncbs (beta-Catenin cKO)	Public	Cryo-S	Mus Musculus	Transgenic (Recombinase)	cryo for Shubha Tole - TIFR Mumbai	compund of MGI:2148567 also available as JAX: 004152 and Foxj1 Cre from DOI: 10.1165/rcmb.2006-0475RC- insertion allele not confirmed.								Shubha Tole (TIFRmumbai), Michael J Holtzman, JAX	This transgene expresses Cre recombinase under the control of 1.2kb of the human FOXJ1 promoter. Cre expression occurs in ciliated epithelial cells present in the pulmonary airways, the choroid plexus, ependyma, oviduct and testis. Their are different variant founder lines of this stock: The line F26 has the highest expression of Cre in the lung compared to the two other founder lines, F14 and F24. (J:136610) Unclear which of these founder line we have here at ACRC.? To cross check with Shubha? PMID: 17255554
acrc:21000246	Foxj1CreERT2::GFP	STOCK Foxj1<tm1.1(cre/ERT2/GFP)Htg>/JNcbs	Public	Live, Cryo-S	Mus Musculus	Targeted (Inducible, Recombinase-expressing, Reporter)	JAX	JAX#27012	MIXED (B6J; CD1; 129P2/OlaHsd; 129S4/SvJaeSor)	Heterozygote x colony Wild-type OR colonyWild-type x Heterozygote; Homozygotes have a postnatal lethal phenotype.	Albino, Black	Homozygotes have a postnatal lethal phenotype.	YES	Wednesday, February 21, 2018	2 (HET X WT) breeding pairs	Global JAX/NCBS/Instem transfer agreements_2017, AG	AG
acrc:22000019	Foxj1CreERT2::GFP; tdTAi14	STOCK Foxj1<tm1.1(cre/ERT2/GFP)Htg>/JNcbs ; B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/JNcbs (tdT or tdTAi14)	Public	Live	Mus Musculus	compound	JAX -> ACRC	compound of JAX#27012 & JAX#007914	MIXED (B6, CD1; 129...)	Foxj1CreERT2::GFP Homozygotes have a postnatal lethal phenotype to Breed as HETs			YES			JAX, Arjun Guha	Foxj1CreERT2::GFP Homozygotes have a postnatal lethal phenotype. AG.
acrc:22000028	Foxj1CreERT2::GFP; tdTAi9	STOCK Foxj1<tm1.1(cre/ERT2/GFP)Htg>/JNcbs ; B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/JNcbs [Ai9(RCL-tdT)]	Public	Cryo-S	Mus Musculus	compound	JAX-> cryo for Shubha Tole - TIFR Mumbai	compound of JAX#27012 & JAX#007909	mixed	Foxj1CreERT2::GFP Homozygotes have a postnatal lethal phenotype to Breed as HETs						JAX, TIFRmumbai - Shuba Tole
acrc:21000092	Foxp3YFP-cre	B6.129(Cg)-Foxp3tm4(YFP/icre)Ayr/JNcbs	Public	Live, Cryo-S	Mus Musculus	Congenic, Targeted Mutation	JAX	JAX# 016959	B6	Homozygote x Hemizygote			N			Global JAX/NCBS/Instem transfer agreements_2017	AS
acrc:21000006	Foxp3YFP-cre, Notch1loxP	Foxp3YFP-cre, Notch1lox/lox	Public	Live	Mus Musculus	Targeted KO, compound	JAX and Freddy Radtke (EPFL)	Components of JAX#016959	B6	Foxp3YFP-cre/WT, Notch1lox/lox (F) X Foxp3YFP-cre +ve, Notch1lox/lox (M)	black		Y			ACRC- AS, JAX	AS
acrc:21000008	Foxp3YFP-cre, RaploxP	Foxp3YFP-cre, Raptor loxP	Public	Live, Cryo-S	Mus Musculus	Targeted KO	JAX - AS	Components of JAX#016959 and JAX# 013188	B6	Foxp3YFP-cre/WT, Raptor lox/WT (F) X Foxp3YFP-cre +ve, Raptor lox/WT (M)	black		Y				AS
acrc:21000362	Foxp3YFPCre, Rap fl, Adipoq-CreER, tdT	B6.129(Cg)-Foxp3tm4(YFP/icre)Ayr/JNcbs , B6.Cg-Rptortm1.1Dmsa/JNcbs, B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/JNcbs (tdT) (Rap^loxP), B6.129Tg(Adipoq-cre/Esr1*)1Evdr/JNcbs,	Public	Live	Mus Musculus	compound	JAX-> Ncbs	compounds of JAX#007914, JAX#016959, JAX#013188, JAX#24671	mixed							JAX, ACRC
acrc:21000068	FVB/N	FVB/NJNcbs	Public	Cryo-S	Mus Musculus	WT	JAX	JAX# 001800		inbred (sibling X sibling)	white albino	exceptional breeder			= old stock imported in 2013 or prior - Filiation unknown	Global JAX/NCBS/Instem transfer agreements_2017	= old stock imported in 2013 or prior - Filiation unknown
acrc:21000255	FVB/N_2018	FVB/NJNcbs	Public	Cryo-E, Cryo-S	Mus Musculus	WT	JAX	JAX# 1800		inbred (sibling X sibling)	albino white	FVB/NJ mice are homozygous for the retinal degeneration 1 allele of Pde6brd1, resulting in blindness by wean age.	NO	Wednesday, February 21, 2018	3 breeding pairs	Global JAX/NCBS/Instem transfer agreements_2017	FVB/NJ mice are homozygous for the retinal degeneration 1 allele of Pde6brd1, resulting in blindness by wean age.
acrc:21000518	Gbx2CreER-IRES-GFP	STOCK Gbx2tm1.1(cre/ERT2)Jyhl/JNcbs	Public	Cryo-S	Mus Musculus	Targeted Mutation	JAX-> TIFRMumbai-> ACRC	JAX#022135								JAX, Shubha Tole - TIFR Mumbai
acrc:21000065	GCaMP 4.3	C57BL/6J-Tg(Thy1-GCaMP6s)GP4.3Dkim/JNcbs	Public	Cryo-S	Mus Musculus	Transgenic (Reporter)	JAX	JAX# 024275		Hemizygote x Noncarrier	black	5-10 pups per litter	N		3 trios	Global JAX/NCBS/Instem transfer agreements_2017	USB
acrc:21000064	GCaMP 5.17	C57BL/6J-Tg(Thy1-GCaMP6f)GP5.17Dkim/JNcbs	Public	Live	Mus Musculus	Transgenic (Inserted expressed sequence)	JAX	JAX# 025393		Hemizygote x Noncarrier	black	5-10 pups per litter	N		3 trios	Global JAX/NCBS/Instem transfer agreements_2017	USB
acrc:21000248	GCaMP 5.17_2018	C57BL/6JTg(Thy1GCaMP6f)GP5.17Dkim/J	Public	Live, Cryo-S	Mus Musculus	Transgenic (Inserted expressed sequence)	JAX	JAX# 25393		Hemizygote x Noncarrier OR Noncarrier x Hemizygote	Black			Wednesday, February 21, 2018	2 (Noncarrier X Hemi) breeding pairs	Global JAX/NCBS/Instem transfer agreements_2017	USB
acrc:21000033	gdTCR KO	gdTCR^-/-	Public	Live	Mus Musculus	isogenic	Havran (TSRI)			Homozygote x Homozygote	Black/Black		no			Havran (TSRI)	CJ
acrc:21000319	GFAPcreER; TCA; Lhx2cKO	Tg(GFAP-cre/ERT2)505Fmv ; TCA-GFP (5-HTT-GFP) ; Lhx2tm1Monu	Public	Live, Cryo-S	Mus Musculus	compound	cryo for Shubha Tole (TIFR Mumbai)	JAX#012849; PMID: 24685175; MGI:3772179								JAX, TCA-GFP from Takuji Iwasato, Division of Neurogenetics, National Institute of Genetics, Mishima 411-8540, Japan, Shubha Tole (TIFRmumbai) for cryo stocks	TCA-GFP= Reporter mice expressing the membrane-bound enhanced GFP from the sensory thalamus-specific serotonin transporter (5-HTT) promoter PMID: 24685175. primers: TCA-GFP-F: ATGCTGTGCTGTATGAGAAGAACCA ; TCA-GFP-R: TTCTCGTTGGGGTCTTTGCT -> 800 bp.
acrc:21000374	Gkn2-lacZ	C57BL/6N-Gkn2tm1.1(KOMP)Vlcg/Mmucd	Public	Live	Mus Musculus	Targeted KI	MMRC_UCDavis	KOMP / MMRRC Stock #: 047863-UCD	C57BL/6N					Thursday, August 1, 2019	Cryorecovered from CryoSperm Vial#12966-16 ( Het sperm)	MMRC - UCDavis	Cryorecovery + IVF on C57Bl6/NJNcbs oocytes. Genotype of recovered animals yet to be confirmed and validated by DP lab
acrc:21000012	gp91phox-	B6.129S-Cybbtm1Din/JNcbs (gp91phox-)	Public	Live, Cryo-S	Mus Musculus	Congenic, Targeted Mutation	JAX	JAX# 002365	B6	heterozygote breeding or Het(f) X (hemizygote male)	black	mutation is X-linked	Y			JAX	AS
acrc:21000247	Grik4cre_2018	C57BL/6Tg(Grik4cre)G324Stl/J	Public	Live, Cryo-S	Mus Musculus	Transgenic (Recombinase-expressing)	JAX	JAX# 6474		Hemizygote x Noncarrier OR Noncarrier x Hemizygote	black		YES	Wednesday, February 21, 2018	2 (Noncarrier X Hemi) breeding pairs	Global JAX/NCBS/Instem transfer agreements_2017	USB
acrc:21000428	H2-M10.2	B6;129P2-H2-M10.2tm2Mom/MomJ	Public	Cryo-S	Mus Musculus	Targeted (Reporter, Null/Knockout)	JAX -> ACRC	JAX#007878						Thursday, August 27, 2020	2 sperm straws	JAX to TIFRHyd, Adish Dani (TIFR Hyd)	Cryo Sperm imported from JAX for Adish Dani on 27 August 2020.
acrc:21000013	H2BeGFP	B6.Cg-Tg(HIST1H2BB/EGFP)1Pa/J	Public	Live, Cryo-S	Mus Musculus	Congenic, Transgenic	JAX	JAX# 006069	B6	Hemizygous x Hemizygous	black		Y			Global JAX/NCBS/Instem transfer agreements_2017	AS
acrc:21000041	Htr2a	B6;129SB6F1-Htr2a^tm1MMP/ncbs	Public	Live, Cryo-E, Cryo-S	Mus Musculus	Targeted Knockout (Exon1 + part of intron2 deletion)	MMP		B6; 129	Homozygous & Heterozygous Breeding	Agouti/ Black	6-9 pups per litter	KOF_GTG GAG AGG CTA TTC GGC TAT GA; KOR_TGC CTC GTC CTG CAG TTC ATT C; WTF_GGT ACC GGT GGC CTT TGC C; WTR_tac gga tat ggt cca cac cgc aat			NCBS ACRC	MMP_______________ original donor ESstrain: G4 ES cells- First Exon + part of Secon intron were deleted. KO PCR band- 200bp; WT PCR band- 201bp
acrc:21000416	Hyh +/-	Hyh +/- [#454 written on casette]	Public	Cryo-S	Mus Musculus		Cryo Sperm Imported for Adish Dani (TIFR Hyd)							Wednesday, July 10, 2019	3 sperm straws	Adish Dani - TIFR Hyderabad	Cryo Sperm Imported for Adish Dani (TIFR Hyd)
acrc:21000442	IFN-γR	C57BL/6N-Ifngr1tm1.1Rds/JNcbs ; interferon gamma receptor 1	Public	Live, Cryo-S	Mus Musculus	Targeted (Conditional ready (e.g. floxed), No functional change)	JAX	JAX#025394	B6N	Homozygote x Homozygote	black			Friday, November 27, 2020	2 males	JAX	Jax notes: "These floxed mutant mice possess loxP sites flanking exon 3 and 4 of the Ifngr1 gene. This strain may be useful for generating conditional mutations in applications related to innate immunity. Mouse mutants involving this gene have been used in studies of Zika virus pathogenesis."
acrc:21000444	Ifnar1-fl	B6(Cg)-Ifnar1tm1.1Ees/JNcbs / interferon (alpha and beta) receptor 1	Public	Cryo-S	Mus Musculus	Targeted (Conditional ready (e.g. floxed), No functional change)	JAX	JAX#028256	B6				YES	Friday, November 27, 2020	2 males	JAX	from Jax: "The Ifnar1fl allele has loxP sites flanking exon 3 of the type-I interferon-α/β receptor gene. The Ifnar1 gene encodes the type-I-IFN-receptor which, upon binding type-I interferons, activates JAK-STAT signaling pathways critical for regulating growth, survival, differentiation, pathogen resistance and anti-viral immune responses. Mice homozygous for the floxed allele are viable and fertile with no reported abnormalities."
acrc:21000565	Ifnb-EYFP, E2-2f	B6.129-Ifnb1tm1Lky/JNcbs [Ifnb-mob or Ifnb-EYFP], Tcf4tm1.1Hmb (E2-2 flox)/Ncbs	Public	Live	Mus Musculus		JAX and Dan Holmberg (Sweden)	JAX# 010818 and MGI:3798811	mixed							JAX, Dan Holmberg (Sweden)	These mice co-express Ifnb1 and EYFP from the Ifnb1 locus
acrc:21000484	Ifnb-mob	B6.129-Ifnb1tm1Lky/JNcbs [Ifnb-mob or Ifnb-EYFP]	Public	Live	Mus Musculus		JAX -> NCBS	JAX# 010818						Thursday, April 15, 2021	2 males	JAX	These mice co-express Ifnb1 and EYFP from the Ifnb1 locus
acrc:21000302	Ift88-fl	B6.129P2-Ift88tm1Bky/JNcbs	Public	Live, Cryo-S	Mus Musculus	Targeted (Conditional ready (e.g. floxed), No functional change)	JAX ->NCBS	JAX# 022409		homozygotes can be bred together	black			Thursday, September 20, 2018	1 breeding pair (Homozygoytes)	Global JAX/NCBS/Instem transfer agreements_2017	Sperm QC efficiency-75.8%
acrc:21000016	Il1r1 -/-	IL-1R^-/- (B6.129S7-Il1r1tm1Imx/J) interleukin 1 receptor, type I	Public	Cryo-S	Mus Musculus	targeted	JAX	JAX# 003245		Homozygote x Homozygote	black	8-10 pups per litter	yes			Global JAX/NCBS/Instem transfer agreements_2017	CJ
acrc:21000059	ILKflox	B6N;129-Ilktm1Star (integrin linked kinase)	Public	Live, Cryo-S	Mus Musculus		Gift by Renec St. Arnaud	MGI:2668459 ; also available as JAX#23310		Homozygote x Homozygote	agouti	4-8 pups per litter	No			Renec St. Arnaud, JAX	SR
acrc:21000384	Jag1-flox	B6;129S-Jag1tm2Grid/JNcbs	Public	Live, Cryo-S	Mus Musculus	Targeted Mutation	JAX -> ACRC	JAX#010618	mixed					Wednesday, November 27, 2019		JAX	These floxed mutant mice possess loxP sites flanking exon 4, which encodes the DSL (Delta-Serrate-Lag2) domain, of the Jag1 gene. This strain may be useful for generating conditional mutations for studies of Notch signaling during development.
acrc:21000477	Jag1-flox, Sox10-Cre	Jag1tm2Grid/JNcbs, Tg(Sox10-cre)1Wdr/JNcbs	Public	Live	Mus Musculus	compound	JAX	compound from JAX#010618 & JAX# 025807	mixed							JAX
acrc:22000024	Jag1-flox; Foxg1-cre [B6J]	B6;129S-Jag1tm2Grid/JNcbs; Foxg1-cre 129(Cg)-Foxg1tm1(cre)Skm/JNcbs XB6JNcbs	Public	Live	Mus Musculus	Compound	Jag1-flox - JAX; Foxg1-Cre - RIKEN-CDB + From Jackson, 花嶋先生 lab - JAX#004337	Jag1-flox- JAX#010618; Foxg1-Cre - RIKEN-CDB + From Jackson, 花嶋先生 lab - JAX#004337
acrc:21000330	K14-K8 WTGFP	FVB- Tg (K14-K8 WTGFP)	Public	Cryo-S	Mus Musculus	transgenic	Cryo for Dr Manoj B Mahimkar - ACTREC		FVB/N					Friday, August 31, 2018		Dr Manoj B Mahimkar - ACTREC	Sperm was very weak at collection time - first Cryo IVF efficiency QC is low- would need to repeat the Cryo for this stock-
acrc:21000329	K14-K8S431A-GFP	FVB- Tg(K14-K8S431A- GFP)	Public	Cryo-S	Mus Musculus	transgenic	Cryo for Dr Manoj B Mahimkar - ACTREC		FVB/N					Friday, August 31, 2018		Dr Manoj B Mahimkar - ACTREC
acrc:21000328	K14-K8S73AGFP	FVB- Tg(K14-K8S73AGFP)	Public	Cryo-S	Mus Musculus	transgenic	Cryo for Dr Manoj B Mahimkar - ACTREC		FVB/N					Friday, August 31, 2018		Dr Manoj B Mahimkar - ACTREC
acrc:21000015	K14Cre (B6)	Tg(KRT14-cre)1Efu/Ncbs (C57BL6)	Public	Live	Mus Musculus	Transgenic	Elaine Fuchs at Rockefeller University			Homozygous breeding	black	10-12 pups per litter	NO			Elaine Fuchs at Rockefeller University, Colin Jamora	CJ
acrc:21000058	K14Cre (CD1)	Tg(KRT14-cre)1Efu/Ncbs [CD1]	Public	Cryo-S	Mus Musculus		Elaine Fuchs (Rockefeller University)				albino	10 to 14 pups per litter	Yes			Elaine Fuchs (Rockefeller University), Srikala Raghavan for Cryo Stocks	SR
acrc:21000409	K14Cre, R26R	K14-Cre (C57BL6), B6.129S4-Gt(ROSA)26Sortm1Sor/JNcbs	Public	Live	Mus Musculus	compound	ACRC / BLiSC	compound of K14Cre (B6) and JAX#003474	mixed							Colin Jamora, JAX
acrc:21000410	K14Cre, R26R, K14Snail	K14Cre (B6), B6.129S4-Gt(ROSA)26Sortm1Sor/JNcbs, K14Snail Tg (CD1)	Public	Live	Mus Musculus	compound	ACRC / BLiSC	components of K14Cre (B6), JAX#003474 and K14Snail (CD1) from Elaine Fuchs	mixed							JAX, Colin Jamora, Elaine Fuchs
acrc:21000020	K14Snail (CD1)	K14 Snail Tg (CD1 background)	Public	Live, Cryo-S	Mus Musculus		Elaine Fuchs (Rockefeller University)				albinos		Yes			Elaine Fuchs (Rockefeller University), Colin Jamora for Cryo	CJ; mice died during shipment; repeated import
acrc:21000233	K14Snail (CD1), PAI-1 KO	K14Snail (CD1), PAI-1 KO	Public	Cryo-S, Discontinued	Mus Musculus		Elaine Fuchs (Rockefeller University) and JAX	components of JAX#002507									Strain is cryopreserved(Sperms) and the live colony is discontinued from March 2024 on request of CJ lab rep and confirmation of PI
acrc:21000019	K14Snail(B6)	K14 Snail Tg (C57Bl6 background)	Public	Live, Cryo-S	Mus Musculus	congenic	Elaine Fuchs (Rockefeller University)			inbred (sibling X sibling)	black	6-8 pups per litter	Yes				CJ
acrc:21000023	K14Snail(B6), Mindin KO	Mindin -/-, K14 Snail Transgenic (C57BL6)	Public	Live	Mus Musculus	compound	Jamora Lab			Mindin^+/-,SnTg x Mindin^+/-, SnTg	Black	6-8 pups per litter	Yes				CJ lab
acrc:21000408	K14Snail(CD1), MindinKO	K14 Snail Tg (CD1 background), Mindin KO (C57Bl6)	Public	Discontinued	Mus Musculus	compound										Elaine Fuchs (Rockefeller University), He Lab (Duke University), Colin Jamora	The live colony is discontinued from March 2024 on request of CJ lab rep and confirmation of PI
acrc:22000065	K14Snail(CD1),Mindin;PAI-1 dKO	K14 Snail Tg (CD1 background), Mindin KO (C57Bl6); B6.129S2-Serpine1tm1Mlg/JNcbs	Public	Discontinued	Mus Musculus	Compound, double knock out	Elaine Fuchs (Rockefeller University) and JAX	K14Snail(CD1),Mindi- Elaine Fuchs (Rockefeller University), He Lab (Duke University), Colin Jamora, PAI-1 KO JAX#002507								K14Snail(CD1),Mindi- Elaine Fuchs (Rockefeller University), He Lab (Duke University), Colin Jamora, PAI-1 KO JAX#002507	The live colony is discontinued from March 2024 on request of the CJ lab rep and confirmation of PI
acrc:21000510	K18-hACE2 [3053]	B6N;DBA2-Tg(K18-hACE2)3053Mgef/Blisc [MEDIUM]	Public	Live, Cryo-S	Mus Musculus	Transgenic	MGEF / Blisc		Dec 2022 - N8 backcross on B6/NJNcbs-2020	Hemi X WT						MGEF / BLiSC	MEDIUM Transgene copy number Line from founder#3053. -- Transgenic- Random insertion of the K18-hACE2 transgene. Mouse model developed at MGEF/ BLiSC facility- The original plasmid used for microinjection is the K18-hACE2 transgene plasmid [PMID: 17079315] kindly donated by Paul B. McCray <paul-mccray@uiowa.edu>. 6 different tg:K18-hACE2 founder Lines were generated at MGEF and are being characterised / analysed and stock amplified- Ready for pre-order. please visit our website for more details on the different series of mouseAce2KO and humanizedACE2 animals generated at MGEF. https://www.ncbs.res.in/research-facilities/acrc-ace2
acrc:21000509	K18-hACE2 [3068]	B6N;DBA2-Tg(K18-hACE2)3068Mgef/Blisc [HIGH]	Public	Live, Cryo-S	Mus Musculus	Transgenic	MGEF / Blisc		Dec 2022 - N8 backcross on B6/NJNcbs-2020	Hemi X WT			Genotyping PROTOCOL: https://drive.google.com/file/d/1OMdvdITB4cJ03aGoZJGOJICR2jieEONd/view?usp=share_link			MGEF / BLiSC	HIGH Transgene copy number Line from founder#3068. -- Transgenic- Random insertion of the K18-hACE2 transgene. Mouse model developed at MGEF/ BLiSC facility- The original plasmid used for microinjection is the K18-hACE2 transgene plasmid [PMID: 17079315] kindly donated by Paul B. McCray <paul-mccray@uiowa.edu>. 6 different tg:K18-hACE2 founder Lines were generated at MGEF and are characterised / analysed and stock amplified- Ready for pre-order. please visit our website for more details on the different series of mouseAce2KO and humanizedACE2 animals generated at MGEF. https://www.ncbs.res.in/research-facilities/acrc-ace2
acrc:24000001	k18-hACE2 [3068]	k18-hACE2 [3068]	Public	Cryo-S	Mus Musculus	k18-hACE2 [3068]	MGEF_NCBS		B6ND2
acrc:21000511	K18-hACE2 [3102]	B6N-Tg(K18-hACE2)3102Mgef/Blisc [LOW]	Public	Cryo-S	Mus Musculus	Transgenic	MGEF / Blisc		july 2021 - N4 backcross on B6/NJNcbs-2020	Hemi X WT						MGEF / BLiSC	LOW Transgene copy number Line from founder#3102. -- Transgenic- Random insertion of the K18-hACE2 transgene. Mouse model developed at MGEF/ BLiSC facility- The original plasmid used for microinjection is the K18-hACE2 transgene plasmid [PMID: 17079315] kindly donated by Paul B. McCray <paul-mccray@uiowa.edu>. 6 different tg:K18-hACE2 founder Lines were generated at MGEF and are being characterised / analysed and stock amplified- Ready for pre-order. please visit our website for more details on the different series of mouseAce2KO and humanizedACE2 animals generated at MGEF. https://www.ncbs.res.in/research-facilities/acrc-ace2
acrc:21000371	K5-CreERT2 KI	B6N.129S6(Cg)-Krt5tm1.1(cre/ERT2)Blh/J	Public	Live	Mus Musculus	Targeted (Recombinase-expressing, Inducible)	JAX	JAX#029155	C57BL/6NJ	Wild-type x Heterozygote OR Heterozygote x Wild-type	black			Friday, September 13, 2019	2 breeding pairs	JAX
acrc:21000287	KCNE1/2 -/-	KCNE1/2 deletion ms(-/-)	Public	Cryo-E	Mus Musculus		RIKEN-CDB + From 京都大学岡崎先生		BDNF					Monday, January 29, 2018	1 CryoVial (= 50 2-cell embryos)	RIKEN-CDB and 京都大学岡崎先生
acrc:21000291	KPCBA	KrasG12D; Trp53R270H; Pdx1-Cre ; Brca2-Tr1491; Brca2-F11; Aldh2tm1a/tm1a	Public	Live, Cryo-S	Mus Musculus	compound	MRC?		Mixed (C57/BL6J; FVB/N; 129Sv)					Friday, June 1, 2018	4 breeding pairs	Ashok V, MRC	compound breeding of 6 different alleles: 1) Lox-STOP-Lox-KrasG12D. 2) Lox-STOP-Lox-Trp53R270H. 3) Pdx1-Cre. 4) BrCa2-Tr1491. 5) BrCa2-F11. 6) Aldh2tm1a/tm1a. - Brca2-Tr allele is embryonic lethal in the homozygous state (not when heterozygous); Only particular combinations of alleles will lead to the appearance of pancreatic tumours, which eventually result in death of the animals.
acrc:21000211	LE-Crl	LONGEVANS - (Charles River)	Public	Live	Rattus norvegicus	WT	Crl		LEH	WT X WT
acrc:21000379	Leh/Arid1b	Leh/Arid1b	Public	Live	Rattus norvegicus		medical college of Wisconsin		LEH					Friday, November 15, 2019
acrc:21000380	Leh/Dyrk	Leh/Dyrk	Public	Live	Rattus norvegicus		medical college of Wisconsin		LEH					Friday, November 15, 2019
acrc:21000378	Leh/Grin2b	Leh/Grin2b	Public	Live	Rattus norvegicus		medical college of Wisconsin		LEH					Friday, November 15, 2019
acrc:21000411	Lewis	LEW/Crl - LEWIS RAT	Public	Live	Rattus norvegicus	INBRED RAT	Charles River UK via Hylasco	LEW/Crl - strain Code: 004			White (albino)			Friday, July 31, 2020	3 breeding pairs	CRL - Hylasco	PV lab
acrc:22000093	Lgals3 KO	B6.Cg-Lgals3tm1Poi/JNcbs	Public	Live	Mus Musculus	Congenic, Targeted Mutation	JAX -> inStem (DBJ lab)	JAX# 006338	B6J background	Homozygote x Homozygote		Homozygotes carrying the lectin, galactose binding, soluble 3 (Lgals3) knock-out have an impaired acute inflammation response, chondrocyte differentiation during long bone development and myofibroblast activation.		Thursday, November 24, 2022	2 Males and 2 Females	JAX	Homozygotes carrying the lectin, galactose binding, soluble 3 (Lgals3) knock-out have an impaired acute inflammation response, chondrocyte differentiation during long bone development and myofibroblast activation. This mutant mouse strain may be useful in studies of bone development, endochondral ossification, inflammatory response, and liver fibrosis.
acrc:23000003	LGN-VenusC	LGN-VenusC (CDB0452K) [(B6)5: GN-venusC#78(neo-/+] ; also known as B6.Cg-Gpsm2<tm1.1(Venus)Fuma>	Public	Cryo-E	Mus Musculus		RIKEN - CDB - KOBE	CDB0452K ; RBRC03511						Tuesday, May 31, 2022	1 embryo vial (CDB0452K)	RIKEN - CDB, Raj Ladher	Cryo Vial of embryos imported from RIKEN on [ 31 May 2022 ] for Raj Ladher Lab.
acrc:21000406	Lgr5-EGFP, tdT	B6.129P2-Lgr5tm1(cre/ERT2)Cle , B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze (tdT)/JNcbs	Public	Live	Mus Musculus	compound	JAX -> ACRC	compound of JAX#008875 and JAX# 007914	mixed B6							JAX
acrc:21000407	Lgr5-EGFP, tdT, Casp1-/-	B6.129P2-Lgr5tm1(cre/ERT2)Cle , B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze (tdT) /JNcbs , Caspase-1 -/-	Public	Live	Mus Musculus	compound	JAX -> ACRC and Jamora Lab UCSD	compound of JAX#008875, JAX# 007914 and Caspase-1 -/-	mixed							JAX, Colin Jamora
acrc:21000373	Lgr5-EGFP-IRES-creERT2	B6.129P2-Lgr5tm1(cre/ERT2)Cle/JNcbs	Public	Live, Cryo-S	Mus Musculus	Targeted (Recombinase-expressing, Reporter, Inducible)	JAX	JAX#008875		+/+ sibling x Heterozygote		homozygous lethal		Friday, September 13, 2019	2 breeding pairs	JAX
acrc:21000308	Lhx2 cKO/ SKO	Lhx2tm1Monu / Lhx2tm1Dra (=Lh2sKO, Lhx -)	Public	Cryo-S	Mus Musculus	compound	Cryo for Shubha Tole (TIFR Mumbai)	MGI:3772179 PMID: 18202285 / MGI:4354122 PMID: 9247336	swiss? - Original Cryo males carried white coat color			Lhx2sKO homozygotes are embryonic lethal (E15.5)		Wednesday, September 7, 2016		Shubha Tole (TIFRmumbai)	SLhx2F: ACCAGACTCAGGGGAAACTCAG; NeoR: ATGCCTGCTTGCCGAATATC; SLhx2R: GTGACTGAACTCCGAACCATTG SLhx2WT: 397 bp; Neo: 600 bp Lhx2cKOF: ACCGGTGGAGGAAGACTTTT; Lhx2cKOR: CAGCGGTTAAGTATTGGGACA Lhx2cKOWT: 144 bp; Conditional: 188 bp
acrc:21000307	Lhx2 cKO; ROSAmTmG/mTmG	Lhx2tm1Monu ; Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo	Public	Cryo-S	Mus Musculus	compound	Cryo for Shubha Tole (TIFR Mumbai)	compound MGI:3772179 ; PMID: 18202285 + JAX# 007676	mixed - original Cryo males were agouti					Friday, September 2, 2016		Shubha Tole (TIFRmumbai) + JAX	Genotyping Primers: Lhx2cKOF: ACCGGTGGAGGAAGACTTTT; Lhx2cKOR: CAGCGGTTAAGTATTGGGACA Lhx2WT: 144 bp; Conditional: 188 bp
acrc:21000309	Lhx2cKO/cKO; Pax6cKO/cKO	Lhx2tm1Monu ; Pax6tm1Ued (=Pax6LoxP)	Public	Cryo-S	Mus Musculus	compound	cryo for Shubha Tole (TIFRmumbai)	MGI:3772179 ; PMID: 18202285 + MGI:4354122; PMID: 19500363	Mixed- Original Cryo Males carried white coat					Friday, September 2, 2016		Shubha Tole (TIFRmumbai) for Cryo Stocks	Pax6 cKOF: AAATGGGGGTGAAGTGTGAG; Pax6cKOR: TGCATGTTGCCTGAAAGAAG Pax6: 156 bp; Pax6Conditional: 195 bp Lhx2cKOF: ACCGGTGGAGGAAGACTTTT; Lhx2cKOR: CAGCGGTTAAGTATTGGGACA Lhx2cKOWT: 144 bp; Lhx2cKOConditional: 188 bp
acrc:21000468	Lmx1aCre	Tg(Lmx1a-EGFP/cre)Kjmi/Ncbs	Public	Cryo-S	Mus Musculus			MGI:4461311								Shubha Tole (TIFRmumbai) for Cryo Stocks	Initially rederived and recryoed from S17_ST_Lmx1aCre/+;Bmp2cko/+;Bmp4cko/+_103. (for IIT-Kanpur- Amitabha)
acrc:21000326	Lmx1aCre/+; Bmp2cko/+; Bmp4cko/+	Tg(Lmx1a-EGFP/cre)Kjmi ; Bmp2cko; Bmp4cko	Public	Cryo-S	Mus Musculus		cryo for Shubha Tole (TIFR Mumbai)	MGI:4461311 + PMID: 17194222(For both Bmp2 and 4)				Lethality for homoz at Bmp2 and 4 loci. Hets survive till adulthood.		Tuesday, June 13, 2017		Shubha Tole (TIFRmumbai) for Cryo Stocks, Bmp2 and Bmp4 double conditional mice were originally generated by Prof. Amitabha Bandyopadhyay's lab, @ IITK, Lmx1aCre is from Prof. Kathy Millen	Bmp2 Forward primer: 5’ GTGTGGTCCACCGCATCAC; Bmp2 Reverse primer: 5’ GGCAGACATTGTATCTCTAGG; -> Bmp2mut: 450bp ; Bmp2WT: 370bp - Bmp4 Forward primer: 5’ AGACTCTTTAGTGAGCATTTTCAAC; Bmp4 Reverse primer: 5’ AGCCCAATTTCCACAACTTC. -> Bmp4mut: 240bp; Bmp4WT: 160bp-
acrc:22000029	Lsd1cKO	B6.129-Kdm1atm1.1Sho/JNcbs	Public	Live	Mus Musculus	Congenic, Targeted Mutation	JAX -> NCBS	JAX#023969		When maintaining a live colony, homozygous mice may be bred together.	Black Coat color	These LSD1fl/fl mutant mice may be useful for studying the epigenetic mechanisms required for proper hematopoietic maturation, as well as the role of LSD1 in activity-evoked transcription of immediate early genes (IEGs) that impact memory formation, emoti		Thursday, April 14, 2022	6 males and 5 Females	JAX
acrc:22000047	Lsd1cKO/+; Ai9/+	B6.129-Kdm1atm1.1Sho/JNcbs; B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/JNcbs [Ai9(RCL-tdT)]	Public	Live	Mus Musculus	Compound	JAX -> NCBS	JAX#023969; JAX#007909								JAX
acrc:21000089	LSL-Cas9 (Rosa26)	B6;129-Gt(ROSA)26Sortm1(CAG-cas9*,-EGFP)Fezh/J (Rosa26-floxed STOP-Cas9 knockin)	Public	Cryo-S	Mus Musculus	Targeted - KI	JAX	JAX# 024857	B6; 129	Heterozygote x Heterozygote OR Homozygote x Homozygote OR Homozygote x Inbred and recip	black		Y	Thursday, January 14, 2016	2 breeding pairs (litter mate homozygotes: DOB- 22 Dec 2015)	Global JAX/NCBS/Instem transfer agreements_2017	MGEF
acrc:21000524	MADM-12-GT; GFAPcreER	MADM-12-GT; Tg(GFAP-cre/ERT2)505Fmv	Public	Cryo-S	Mus Musculus	compound	cryo for Shubha Tole - TIFR Mumbai	Mosaic Analysis with Double Markers (MADM) alleles not yet referenced? + JAX#012849								JAX, MADM alleles from Simon Hippenmeyer (IST Austria), Shubha Tole (TIFR Mumbai)	MADM publication-Cell reports: DOI:https://doi.org/10.1016/j.celrep.2021.109274 - Mosaic Analysis with Double Markers (MADM) offers a unique approach to visualize and concomitantly manipulate genetically-defined cells in mice with single-cell resolution.
acrc:21000523	MADM-12-TG; Foxg1cKO	MADM-12-TG; Foxg1tm1Fsh	Public	Cryo-S	Mus Musculus	compound	cryo for Shubha Tole - TIFR Mumbai	Mosaic Analysis with Double Markers (MADM) alleles not yet referenced? + J:188355								Foxg1: Gordon Fishell, NYU Neuroscience Institute (PMID: 22726835) , , MADM alleles from Simon Hippenmeyer (IST Austria) , , Shubha Tole (TIFR Mumbai)	MADM publication-Cell reports: DOI:https://doi.org/10.1016/j.celrep.2021.109274 - Mosaic Analysis with Double Markers (MADM) offers a unique approach to visualize and concomitantly manipulate genetically-defined cells in mice with single-cell resolution.
acrc:21000520	MADM-2-GT	MADM-2-GT	Public	Cryo-S	Mus Musculus		cryo for Shubha Tole - TIFR Mumbai	Mosaic Analysis with Double Markers (MADM) alleles not yet referenced?								Shubha Tole (TIFRmumbai), MADM alleles from Simon Hippenmeyer (IST Austria)	MADM publication-Cell reports: DOI:https://doi.org/10.1016/j.celrep.2021.109274 - Mosaic Analysis with Double Markers (MADM) offers a unique approach to visualize and concomitantly manipulate genetically-defined cells in mice with single-cell resolution.
acrc:21000519	MADM-2-TG; Lhx2 cKO	MADM-2-TG; Lhx2tm1Monu	Public	Cryo-S	Mus Musculus		cryo for Shubha Tole - TIFR Mumbai	compound of Mosaic Analysis with Double Markers (MADM) alleles not yet referenced? & MGI:3772179								Shubha Tole (TIFRmumbai), MADM alleles from Simon Hippenmeyer (IST Austria)	MADM publication-Cell reports: DOI:https://doi.org/10.1016/j.celrep.2021.109274 - Mosaic Analysis with Double Markers (MADM) offers a unique approach to visualize and concomitantly manipulate genetically-defined cells in mice with single-cell resolution.
acrc:21000522	MADM-9-GT	MADM-9-GT	Public	Live, Cryo-S	Mus Musculus		cryo for Shubha Tole - TIFR Mumbai	Mosaic Analysis with Double Markers (MADM) alleles not yet referenced?								Shubha Tole (TIFRmumbai), MADM alleles from Simon Hippenmeyer (IST Austria)	MADM publication-Cell reports: DOI:https://doi.org/10.1016/j.celrep.2021.109274 - Mosaic Analysis with Double Markers (MADM) offers a unique approach to visualize and concomitantly manipulate genetically-defined cells in mice with single-cell resolution.
acrc:21000521	MADM-9-TG	MADM-9-TG	Public	Cryo-S	Mus Musculus		cryo for Shubha Tole - TIFR Mumbai	Mosaic Analysis with Double Markers (MADM) alleles not yet referenced?								Shubha Tole (TIFRmumbai), MADM alleles from Simon Hippenmeyer (IST Austria)	MADM publication-Cell reports: DOI:https://doi.org/10.1016/j.celrep.2021.109274 - Mosaic Analysis with Double Markers (MADM) offers a unique approach to visualize and concomitantly manipulate genetically-defined cells in mice with single-cell resolution.
acrc:21000548	Malat1 KO	Malat1tm1.2Dlsp	Public	Live, Cryo-S	Mus Musculus	targeted KO		MGI:5496055	original: (C57BL/6 x 129S4/SvJae)F1					Wednesday, November 3, 2021	2 males and 2 females for rescue breeding and cryo	IISc- Rescue Breeding Request for Prof. K.N. Balaji / IISc, original Stock from: Prof David L. Spector- CSHL [Cold Spring Garbor Lab- USA]
acrc:21000236	Mdx_2017	C57BL/10ScSnDmd< mdx>/J Ncbs	Public	Cryo-E	Mus Musculus	Homozygote Females / Hemizygotes Males (spontanous mutation on X)	JAX	JAX#001801	C57BL/10					Wednesday, September 13, 2017	3 breeding pairs	JAX NCBS/Instem agreements
acrc:21000055	Mesp1Cre	Mesp1tm2(cre)Ysa/Ncbs	Public	Live, Cryo-S	Mus Musculus	KI	Pasteur Institute Paris	MGI:2176467					Y			Pasteur Institute Paris	RS
acrc:21000022	MindinKO(B6)	Mindin KO (C57Bl6)	Public	Live	Mus Musculus		He Lab (Duke University)			KO X KO	Black	6-8 pups per litter	No			He Lab (Duke University), Colin Jamora	CJ
acrc:21000546	MindinKO(CD1)	Mindin KO (CD1)	Public	Discontinued	Mus Musculus	Compound	He Lab (Duke University)		CD1 background	KO X KO						He Lab (Duke University), Colin Jamora	The live colony is discontinued from March 2024 on request of the CJ lab rep and confirmation of PI
acrc:23000031	Mns1(dex3/+)#14	Mns1(dex3/+)#14[RIKEN]	Public	Cryo-S	Mus Musculus		RIKEN [CDB0299E]							Monday, April 3, 2023	Imported 2 straws of Sperms
acrc:21000137	Myf5Cre	B6;129-Myf5tm1(cre)Mrc/JNcbs	Public	Cryo-S	Mus Musculus	Targeted Mutation	JAX	JAX# 010529		Homozygote x Homozygote OR Heterozygote breeding					5 hets	JAX, Ramkumar Sambasivan	Sperm Donor Genotype not yet confirmed.
acrc:21000052	Myf5nlacz	Myf5tm1Pas/Ncbs	Public	Live, Cryo-S	Mus Musculus	Targeted (Null/knockout, Reporter) - KI	Tajbakhsh Lab (Pasteur Institute Paris)	MGI:1857973 or JAX# 018626	mixed	(f)B6D2F1 X (m)Myf5nlacZ/+ heterozygote breeding	Black	8-12 pups per litter	Y			JAX, Ramkumar Sambasivan	RS
acrc:21000036	MYH7hum	C57BL/6NTac-Myh6^tm3169(MYH7)Arte/Ncbs	Public	Live, Cryo-E, Cryo-S	Mus Musculus	Knock-in (whole-gene replacement - humanized)	John Mercer - made at TaconicArtemis		intercrossed since 2013?	hum/+ x +/+ or hum/+ intercross (either direction)	black		Y	Saturday, November 14, 2015		Instem - ACRC	JAM
acrc:22000007	NesCre	Tg(Nes-cre)1Kln/CjDswJNcbs [Nestin Cre]	Public	Live, Cryo-S	Mus Musculus		Rederived from Shubha Tole NesCre/+, Lhx2SKO/+ Cryo Stocks	JAX#019103								JAX, BLiSC	Rederived from S17_ST_NesCre/+;Lhx2sko/+_102. on B6N background and then maintained by Bhavana's Lab. Lhx2 allele was outcrossed.
acrc:21000325	NesCre/+, Lhx2SKO/+	B6N.Cg-Tg(Nes-cre)1Kln/CjDsw/+ [Nestin Cre], Lhx2tm1Dra (=Lh2sKO, Lhx -)	Public	Cryo-S	Mus Musculus	compound	cryo for Shubha Tole (TIFR Mumbai)	JAX#019103 + MGI:1890208				Lhx2sKO homozygotes are embryonic lethal (E15.5)	Nes-cre Transgene is mapped to Chr12- JAX Genotype protocol same as for JAX stock #003771	Monday, June 13, 2016		Shubha Tole (TIFRmumbai) for Cryo Stocks, JAX (Nesting Cre allele)	The Nestin Cre allele was initially wrongly referenced as the Amelia Eisch Nestin CreERT2 allele- But Shubha corrected this: THIS IS NOT the NestinCreERT2 allele from Amelia Eisch. It's a constitutive Nes-Cre promoter (originally from JAX#019103). Nes-Cre Transgene is mapped to Chr12- JAX genotyping proctocol same as for JAX Genotype protocol same as for JAX stock #003771 = able to distiguish hemi from homo: https://www.jax.org/Protocol?stockNumber=003771&protocolID=31758
acrc:22000051	NesCre/NesCre; Ai9/Ai9	Tg(Nes-cre)1Kln/CjDswJNcbs [Nestin Cre]; B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/JNcbs [Ai9(RCL-tdT)]	Public	Live, Cryo-S	Mus Musculus	Compound	Shubha Tole (TIFRmumbai), JAX	Ai9 allele originally from JAX#007909; Nes cre- JAX#019103	Mixed	Homozygote x Homozygote						JAX
acrc:21000349	Nestin-cre/ERT2 AE	C57BL/6-Tg(Nestin-cre/ERT2)KEisc/Ncbs	Public	Live, Cryo-S	Mus Musculus	Transgenic (Recombinase-expressing, Inducible)	imported to ACRC from Vidita Vaidya (TIFR Mumbai) - Original Stock from Amelia Eisch - UPenn	MGI:3767432 - also available as JAX stock#016261								Amelia Eisch - eisch@upenn.edu ; Amelia.Eisch@utsouthwestern.edu, JAX
acrc:21000348	Nestin-GFP	Tg(Nestin-rtTA*M2,-EGFP)Sker (PN18 or PN9 insertion?)	Public	Live, Cryo-S	Mus Musculus	Transgenic (Reporter, Transactivator)	imported to ACRC from Vidita Vaidya (TIFR Mumbai) - Original Stock from Steven G Kernie- Columbia University	MGI:6193952 OR MGI:6193950 alleles to be confirmed								Steven G Kernie - Columbia University
acrc:21000315	NestinCreERT2/+, Lhx2cKO/cKO; Pax6 cKO/+	Nestin Cre ERT2? [TBD] ; Lhx2tm1Monu; Pax6tm1Ued (=Pax6LoxP)	Public	Cryo-S	Mus Musculus	compound	cryo for Shubha Tole (TIFR Mumbai)	nestingCre? + MGI:3772179 + MGI:4354122	mixed					Wednesday, January 25, 2017		Shubha Tole (TIFRmumbai) for Cryo Stocks, NestinCre under an MTA with ShubhaTole TIFR Mumbai & Amelia Eisch (Amelia.Eisch@utsouthwestern.edu)	Jan2019- After Having rederived this stock for HSG - zero Cre positive animals were found + there seems to be a confusion on the original Nestin Cre allele of this stock- This needs to be clarified with Shubha again.
acrc:21000100	NestinGFCreER	Tg(Nestin-cre/ERT2)1Fsh (= NestinCreERT2, Tg(Nes-cre/ESR1)1Fsh)	Public		Mus Musculus	Transgenic (Inducible, Recombinase)	Gordon Fishell (NY)	MGI:3774417								Gordon Fishell (NY)	HSG
acrc:21000116	NestinGFCreER, E2-2f/f	Tg(Nestin-cre/ERT2)1Fsh, Tcf4tm1.1Hmb	Public	Live	Mus Musculus		Gordon Fishell (NY) + Dan Holmberg (Sweden)	components of MGI:3774417 and MGI:3798811	B6;129								HSG
acrc:21000101	NestinRHCreER	Tg(Nestin-cre/ERT2)1Rhn (= Nestin-CreERT2)	Public		Mus Musculus	Transgenic	Rene Hen (NY)	PMID: 21658584								Rene Hen (NY)	HSG PMID: 21658584
acrc:21000169	NestinRHCreER, Stim f/+	NestinRHCreER, Stim f/+	Public	Live	Mus Musculus
acrc:21000170	NestinRHCreER, Stim f/f	NestinRHCreER, Stim f/f	Public	Live, Cryo-E, Cryo-S	Mus Musculus												GH
acrc:21000382	Neurog1-CreERT2	B6;129P-Tg(Neurog1-cre/ERT2)1Good/JNcbs	Public	Live, Cryo-S	Mus Musculus	transgenic Cre	JAX -> ACRC	JAX#008529	mixed B6J & 129P					Wednesday, November 27, 2019		JAX	Sperm QC efficiency:23.07% Control efficiency for QC Session:98.03%
acrc:22000069	Neurog1-CreERT2, R26R-Confetti	B6;129P-Tg(Neurog1-cre/ERT2)1Good/JNcbs ; B6.129P2-Gt(ROSA)26Sortm1(CAG-Brainbow2.1)Cle/JNcbs -[R26R-Confetti]	Public	Live	Mus Musculus	compound	BLiSC	compound of JAX#008529 and JAX# 017492	mixed							JAX, Raj Ladher
acrc:21000321	Nex Cre/Cre, TCA/+, Lhx2cKO/cKO	Neurod6tm1(cre)Kan [Nex Cre] ; TCA-GFP (5-HTT -GFP) ; Lhx2tm1Monu	Public	Cryo-S	Mus Musculus	compound	cryo for Shubha Tole (TIFR Mumbai)	MGI:2668659 + PMID: 24685175 + MGI:3772179	mixed					Thursday, January 26, 2017		Shubha Tole (TIFRmumbai) for Cryo Stocks, TCA-GFP from Takuji Iwasato, Division of Neurogenetics, National Institute of Genetics, Mishima 411-8540, Japan	NexF: GAGTCCTGGAATCAGTCTTTTTC; NexR: AGAATGTGGAGTAGGGTGAC; NexCre-MutR: CCGCATAACCAGTGAAACAG. ->NexWT =770 bp ; Nexcre= 525 bp. TCA-GFP= Reporter mice expressing the membrane-bound enhanced GFP from the sensory thalamus-specific serotonin transporter (5-HTT) promoter PMID: 24685175. primers: TCA-GFP-F: ATGCTGTGCTGTATGAGAAGAACCA ; TCA-GFP-R: TTCTCGTTGGGGTCTTTGCT -> 800 bp.
acrc:21000028	NF1 fl/fl, K14Cre(B6)	NF1 fl/fl, K14Cre(B6)	Public	Live, Cryo-S	Mus Musculus	congenic	Jamora Lab	NF1flox allele also available as JAX#017639		heterozygote X homozygote	Black		Yes			JAX, Colin Jamora	Stock Cryoarchived for CJ lab. - The Nf1flox mice possess loxP sites flanking exons 31-32 of the neurofibromatosis 1 gene (Nf1), and have applications in studying cancer, neural crest development and neurofibromatosis type I.
acrc:21000324	Nfia+/-	Nfiatm1Rmg	Public	Cryo-S	Mus Musculus		cryo for Shubha Tole (TIFR Mumbai)	PMID: 20610746				Embryos homozygous for Nfia null allele are lethal-		Friday, June 30, 2017		Shubha Tole (TIFRmumbai) for Cryo Stocks	Nfia Fwd: CGTGAGCTGGTACAGTTTGCA ; Nfia R: TGTTTGAGAATCTTTCTTCCTTTGG; Nfia-neoR: GCCTGAAGAACGAGATCAGCA. -> NfiaMutant ~350bp ; NfiaWT ~500 bp.
acrc:21000322	Nfia+/-; Lhx2cKO/cKO	Nfiatm1Rmg ; Lhx2tm1Monu	Public	Cryo-S	Mus Musculus	compound	cryo for Shubha Tole (TIFR Mumbai)	PMID: 20610746 + MGI:3772179	mixed			Embryos homozygous for Nfia null allele are lethal		Tuesday, February 7, 2017		Shubha Tole (TIFRmumbai) for Cryo Stocks	Nfia Fwd: CGTGAGCTGGTACAGTTTGCA ; Nfia R: TGTTTGAGAATCTTTCTTCCTTTGG; Nfia-neoR: GCCTGAAGAACGAGATCAGCA. -> NfiaMutant ~350bp ; NfiaWT ~500 bp.
acrc:21000383	Ngn1-457Cre	STOCK Tg(Neurog1-cre)1Jejo/JNcbs	Public	Live	Mus Musculus	transgenic Cre	JAX -> ACRC	JAX#012859	mixed - (C57BL/6J & SJL/J)					Wednesday, November 27, 2019		JAX
acrc:23000014	Ngn1-457Cre; Jag1-flox	STOCK Tg(Neurog1-cre)1Jejo/JNcbs; B6;129S-Jag1tm2Grid/JNcbs	Public	Live	Mus Musculus	Compound	Ngn1-457Cre - JAX, Jag1-flox - JAX	Ngn1-457Cre- JAX#012859, Jag1-flox- JAX#010618								JAX
acrc:21000458	Ngn1-457Cre; R26R-Confetti	STOCK Tg(Neurog1-cre)1Jejo/JNcbs; B6.129P2-Gt(ROSA)26Sortm1(CAG-Brainbow2.1)Cle/JNcbs [R26R-Confetti]	Public	Live	Mus Musculus	compound	JAX -> NCBS	compound of JAX#012859 and JAX#017492	mixed							JAX	RL lab
acrc:21000475	Ngn1-457Cre; R26R-Mito-EGFP	STOCK Tg(Neurog1-cre)1Jejo/JNcbs, R26R-Mito-EGFP/MitoG#22(loxP/loxP)	Public	Live	Mus Musculus	compound	JAX -> NCBS & RIKEN-CDB	compound of JAX#012859, & CDB0216K	mixed							JAX, Riken-CDB (Kobe)
acrc:21000072	NODscid	NOD.CB17Prkdc<scid>/JNcbs	Public	Cryo-S, Discontinued	Mus Musculus	Spontaneous mutation	JAX	JAX# 001303		Homozygote x Homozygote	white albino	good breeder			= old stock imported in 2013 or prior - Filiation unknown	Global JAX/NCBS/Instem transfer agreements_2017	AF - Very old stock - now leaky- = old stock imported in 2013 or prior - Filiation unknown- we strongly recommend you use the NSG (JAX#005557) stocks instead-
acrc:21000412	Notch-4-loxP	Notch4lox/lox	Public	Live, Cryo-S	Mus Musculus	Targeted Lox/Lox	Apurva Sarin		B6							ACRC- AS
acrc:21000111	NPHS2cre	B6.Cg-Tg(NPHS2-cre)295Lbh/JNcbs ( => 2.5P-Cre)	Public	Live, Cryo-S	Mus Musculus	Congenic, Transgenic (Recombinase-expressing)	JAX	JAX# 008205		Noncarrier x Hemizygote	black		Y	Friday, October 10, 2014	5 females + 4 males	JAX	Stock Cryopreserved for Maneesha Inamdar (JNCSAR).
acrc:22000063	NPY-Cre	B6.Cg-Npytm1(cre)Zman/JNcbs	Public	Live	Mus Musculus	Congenic, Targeted Mutation	JAX -> NCBS	JAX# 027851		Homozygote x Homozygote, Homozygous and heterozygous mice are viable and fertile.	Black Coat color			Tuesday, August 9, 2022	2F + 2M	JAX	Imported for Prof. Upi Bhalla.
acrc:21000235	NSG_2017	NOD.Cg-Prkdc<scid> Il2rg<tm1Wjl>/SzJNcbs	Public	Live, Cryo-E, Cryo-S	Mus Musculus	immunocompromised / double mutant	JAX	JAX#005557				Females are Homozygotes for Prkdc<scid> and Il2rg<tm1Wjl>- Males are Homozygotes for Prkdc<scid> and hemizygotes for Il2rg<tm1Wjl>		Wednesday, September 13, 2017	2 breeding pairs	NSG mice require Lab PI specific JAX MTAs, _active NSG MTAs for: CJ + JD + MI + SR + SRD + HSG + SK _
acrc:21000439	NSG_2020	NOD.Cg-Prkdc<scid> Il2rg<tm1Wjl>/SzJNcbs	Public	Live, Cryo-E, Cryo-S	Mus Musculus	immunocompromised / double mutant	JAX	JAX#005557	NOD		albino	Females are Homozygotes for Prkdc<scid> and Il2rg<tm1Wjl>- Males are Homozygotes for Prkdc<scid> and hemizygotes for Il2rg<tm1Wjl>		Friday, November 27, 2020	5 breeding pairs	JAX	NSG mice require Lab PI specific JAX MTAs, _active NSG MTAs for: CJ + JD + MI + SR + SRD + HSG + SK
acrc:21000438	NUde_2020	NU/JNcbs ; Foxn1^ nude	Public	Live, Cryo-E, Cryo-S	Mus Musculus	inbred, spontaneous mutation, immunodeficient	JAX	JAX#002019		HET X HET or HOMO (males) X HET (females) - Homo females are very poor breeders	HET or WT (albino) ; HOMO (hairless)		YES	Friday, November 27, 2020	4 HET breeding pairs	JAX	from Jax: "The two main defects of mice homozygous for the nude spontaneous mutation (Foxn1nu, formerly Hfh11nu) are abnormal hair growth and defective development of the thymic epithelium. Nude mice are also athymic; homozygous nude mice lack T cells and suffer from a lack of cell-mediated immunity. Homozygous nude mice show partial defect in B cell development. Homozygous nude females are not effective breeders. Ovulation starts late at 2.5 months and ends early at 4 months. "
acrc:23000080	NUde_2023	NU/JNcbs ; Foxn1^ nu	Public	Live	Mus Musculus	Inbred Strain	JAX	JAX#002019	Foxn1<nu>	Heterozygote x Homozygote	albino, without hair Related Genotype: A/A Tyrc/Tyrc Foxn1nu/Foxn1nu: albino, with hair Related Genotype: A/A Tyrc/Tyrc Foxn1nu/+			Thursday, December 7, 2023	6 female and 3 males	JAX:002019	Homozygous nude females are not effective breeders. Ovulation starts late at 2.5 months and ends early at 4 months. The two main defects of mice homozygous for the nude spontaneous mutation (Foxn1nu, formerly Hfh11nu) are abnormal hair growth and defective development of the thymic epithelium. Nude mice are also athymic; homozygous nude mice lack T cells and suffer from a lack of cell-mediated immunity. Homozygous nude mice show partial defect in B cell development.
acrc:21000161	Oct4GFP	Tg(Pou5f1-EGFP)2Mnn/Ncbs (=Oct4-DPE-GFP, OG2, TgOG2)	Public	Cryo-S	Mus Musculus	Transgenic (Reporter)	Richard Harvey or Dr. Hans R. Schöler (Max Planck)?	MGI:3057158 or JAX#004654								Dr. Hans R. Schöler (Max Planck)	JD
acrc:21000413	OMP-Cre	B6;129P2-Omptm4(cre)Mom/MomJ	Public	Cryo-S	Mus Musculus		JAX -> ACRC	JAX#006668						Thursday, August 27, 2020	2 sperm straws	JAX to TIFRHyd, Adish Dani (TIFR Hyd)	Cryo Sperm imported from JAX for Adish Dani on 27 August 2020. - 2straws received - Cryo-recovered / rederived on B6/JNcbs for Adish Dani (September 2020)
acrc:21000419	OMP:Chr2-YFP	OMP:Chr2-YFP (AD) #460-1 written on casette	Public	Cryo-S	Mus Musculus		Cryo Sperm Imported for Adish Dani (TIFR Hyd)							Wednesday, July 10, 2019	3 sperm straws	Adish Dani - TIFR Hyderabad	Cryo Sperm Imported for Adish Dani (TIFR Hyd)
acrc:21000364	OT-1	C57BL/6-Tg(TcraTcrb)1100Mjb/J	Public	Live, Cryo-S	Mus Musculus	Transgenic (Inserted expressed sequence)	JAX	JAX#003831	C57BL/6J	Homozygote X Homozygote or Hemizygote X C57BL/6J	black			Friday, September 13, 2019	2 breeding pairs	JAX	TIFRHyd stocks- Like most TCR transgenics, these mice are somewhat immunodeficient.
acrc:21000088	OT-II	B6.Cg-Tg(TcraTcrb)425Cbn/JNcbs	Public	Live, Cryo-S	Mus Musculus	Congenic, Transgenic (Inserted expressed sequence)	JAX	JAX# 004194	B6	Homozygote x Homozygote		good breeder	N				AS
acrc:21000365	OT-II_2019	B6.Cg-Tg(TcraTcrb)425Cbn/JNcbs	Public	Cryo-S	Mus Musculus	Transgenic (Inserted expressed sequence)	JAX	JAX#004194	C57BL/6J	Homozygote x Homozygote	black			Friday, September 13, 2019	2 breeding pairs	JAX to TIFRHyd	TIFRHyd.
acrc:21000113	Padosan lox	Padosan lox/lox	Public	Live, Cryo-S	Mus Musculus		RIKEN		original: C57BL/6 × CBA ? / MIXED	Homozygote x Homozygote	black eye /agouti coat						Stock Cryopreserved for Maneesha Inamdar (JNCSAR).
acrc:21000024	PAI-1 KO	B6.129S2-Serpine1tm1Mlg/JNcbs	Public	Live, Cryo-S	Mus Musculus	congenic	JAX	JAX#002507		het X knock-out	black	6-8 pups per litter	Yes			Global JAX/NCBS/Instem transfer agreements_2017	CJ
acrc:21000445	PARP1-KO	129S-Parp1tm1Zqw [ADPRT]	Public	Live, Cryo-S	Mus Musculus	ko	JAX-> IISc-> NCBS	JAX#002779								JAX, IISc - N. Ravi Sundaresan <rsundaresan@iisc.ac.in>	mice maintained in V1 for DP lab / IISC Ravi Sundaresan collaborative work.
acrc:21000313	Pax6+/- ; Lhx2cKO/cKO	Pax6 small eye ; Lhx2tm1Monu	Public	Cryo-S	Mus Musculus	compound, cKO	cryo for Shubha Tole (TIFR Mumbai)	MGI:1856155 ; PMID: 8951061 + MGI:3772179 ; PMID: 18202285	mixed - original Cryo males were agouti			Pax6 small eye -/- mutants are Lethal; Perinatal death.		Wednesday, November 23, 2016		Shubha Tole (TIFRmumbai) for Cryo Stocks	Pax6 +/- : Phenotypically distinguished by presence of small eye
acrc:21000049	Pax7CreERT2	B6;129-Pax7tm2.1(cre/ERT2)Fan/JNcbs	Public	Cryo-S	Mus Musculus	KI - Targeted Mutation	JAX	Jax# 012476		heterozygote breeding	Black	8 to 12 pups per litter	Y				genotype of sperm donor animals not fully confirmed- Only one lysate(Biopsy ID-1330) out of the three different donor males shown to give positive band for CRE.
acrc:21000050	Pax7GPL	Pax7tm1Tajb/Ncbs (= Pax7nGFP-Puro/nlacZ)	Public	Cryo-S	Mus Musculus	Targeted KI (Null/knockout, Reporter)	Tajbakhsh Lab (Pasteur Institute Paris)	MGI:3850147			Black	8 to 12 pups per litter	N			Tajbakhsh Lab (Pasteur Institute Paris)	RS
acrc:21000048	Pax7nGFP	Tg(Pax7-EGFP)Tajb/Ncbs	Public	Cryo-S	Mus Musculus	Transgenic	Tajbakhsh Lab (Pasteur Institute Paris)	MGI:5308730		Homozygous breeding	Black	good litter size (8-12 pups)	N				RS, JD
acrc:22000090	Pcdh15-n38YF-HA	Pcdh15 Swap Mt ex 38#28(KI/+) F1 EMZY; Tg(Pgk1-cre)1Lni/Ncbs	Public	Live	Mus Musculus	Compound	Pcdh15 Mt EX38-flag- RIKEN, CDBO186E; PGK cre- Pasteur Institute Paris (Yvan Lallemand), MGI:2178050 ; also available as JAX#020811 (on B6)	Pcdh15 Mt EX38-flag- RIKEN, CDBO186E; PGK cre- Pasteur Institute Paris (Yvan Lallemand), MGI:2178050 ; also available as JAX#020811 (on B6)								RIKEN-CDB and Pasteur Institute Paris (Yvan Lallemand)	Pcdh15-n38YF-HA - cross of Pcdh15 mt ex38-flag with pgk-cre. It will change all the tyrosine residues to phelyalanine on exon 38 of pcdh15 and than tagged with HA tag, which will be different than normal Pcdh15 mt ex38-flag.
acrc:21000034	Pcp2Cre	B6.129-Tg(Pcp2-cre)2Mpin/JNcbs	Public	Live, Cryo-S	Mus Musculus	Transgenic (Recombinase-expressing)	JAX	JAX# 004146	B6.129	Homozygote x Homozygote	black	6 to 9 litter size. Gender varies with each litter.Canabilization was observed in two cages twice	Yes		3 breeding pairs	JAX - NCBS relocation agreements
acrc:21000091	Pcp2EGFP	B6;FVB-Tg(Pcp2-EGFP)2Yuza/JNcbs	Public	Cryo-E, Cryo-S	Mus Musculus	Transgenic (Reporter)	JAX	JAX# 004690	B6;FVB	Hemizygous x Hemizygous	black	8-12 pups per litter	Y		3 breeding pairs	JAX - NCBS relocation agreements
acrc:21000009	PepBoy	B6.SJL-Ptprca Pepcb/BoyJNcbs	Public	Cryo-S	Mus Musculus	Congenic	JAX	JAX# 002014		inbred (sibling X sibling)	black		N			JAX - NCBS relocation agreements	FO cryopreserved
acrc:21000367	PepBoy_2019	B6.SJL-Ptprca Pepcb/BoyJNcbs	Public	Live, Cryo-E, Cryo-S	Mus Musculus		JAX	JAX#002014	C57BL/6J	sibing X sibling	black			Friday, September 13, 2019	2 breeding pairs	JAX to TIFRHyd, JAX instem/ncbs agreements	TIFRHyd- This C57BL/6 congenic strain is used widely in transplant studies because it carries the differential pan leukocyte marker Ptprca, commonly known as CD45.1 or Ly5.1. Wild-type C57BL and BALB/c inbred strains express the Ptprcb (CD45.2 or Ly5.2) allele.- A spontaneous mutation in the Ncr1 gene is segregating in this strain-
acrc:21000051	PGKCre	Tg(Pgk1-cre)1Lni/Ncbs	Public	Live, Cryo-S	Mus Musculus	Transgenic (Recombinase)	Pasteur Institute Paris (Yvan Lallemand)	MGI:2178050 ; also available as JAX#020811 (on B6)	mixed (strain of origin: (BALB/c x C57BL/6)F2)	Homozygous breeding	Coco or Black	8-12 pups per litter	N			Pasteur Institute Paris (Yvan Lallemand), JAX	RS
acrc:21000206	PGKCre, tdT	Tg(Pgk1-cre)1Lni, B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J (tdT) [Ncbs]	Public	Live	Mus Musculus	compound	Pasteur Institute Paris (Yvan Lallemand) + JAX# 007914	components of MGI:2178050 and JAX# 007914									RS
acrc:21000179	PGKCre, Twist1 fl/fl	Tg(Pgk1-cre)1Lni , Twist1tm2Bhr	Public	Live	Mus Musculus	double compound		components of MGI:2178050 , MGI:3768516	mixed							RS, Pasteur Institute Paris, Richard R Behringer
acrc:22000017	PGKCre; Csf1r Flox	Tg(Pgk1-cre)1Lni/Ncbs; B6.Cg-Csf1rtm1.2Jwp	Public	Live	Mus Musculus	Compound	JAX -> NCBS	PGKCre- MGI:2178050 ; also available as JAX#020811 (on B6), Csf1r Flox- JAX#021212								JAX- Csf1r Flox, Pasteur Institute Paris (Yvan Lallemand)- PGKCre
acrc:21000303	PLPcreER	B6.Cg-Tg(Plp1-cre/ERT)3Pop/JNcbs	Public	Live, Cryo-S	Mus Musculus	Transgenic (Recombinase-expressing, Inducible)	JAX ->NCBS	JAX# 005975	C57BL/6J	Hemizygote x +/+ sibling OR Hemi X Hemi	black			Thursday, September 20, 2018	1 breeding pair (Hemizygoytes)	JAX
acrc:21000466	PLPcreER, R26R-Mito-EGFP	Tg(Plp1-cre/ERT)3Pop/JNcbs, R26R-Mito-EGFP/MitoG#22(loxP/loxP)	Public	Live	Mus Musculus		JAX & RIKEN CDB	compound of JAX# 005975 and RIKEN# CDB0216K	mixed							JAX, Riken-CDB (Kobe)
acrc:21000497	PLPcreER; tdTomatoAi14	B6.Cg-Tg(Plp1-cre/ERT)3Pop/JNcbs ; B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/JNcbs (tdT)	Public	Live	Mus Musculus		JAX -> NCBS	compound JAX# 005975 & JAX# 007914								JAX
acrc:21000366	Prf1 KO	C57BL/6-Prf1tm1Sdz/J	Public	Cryo-S	Mus Musculus	Targeted (Null/Knockout)	JAX	JAX#002407	C57BL/6J	Homozygote x Homozygote	black			Friday, September 13, 2019	2 breeding pairs	JAX to TIFRHyd	TIFRHyd- This colony is maintained by breeding homozygous siblings; reproduction performance is similar to C57LB/6J. Young mutants are susceptible to mouse hepatitis virus, but after reaching about eight weeks of age, they survive well conventional animal housing conditions. The expected coat color from breeding is black.
acrc:21000296	R26-DTAlky	B6.129P2-Gt(ROSA)26Sortm1(DTA)Lky/JNcbs -[R26-DTAlky]	Public	Live	Mus Musculus	Targeted (Conditional ready (e.g. floxed), Inserted expressed sequence, No functional change)	JAX ->NCBS	JAX# 009669	B6	Homozygote x Homozygote	black			Thursday, September 20, 2018	1 breeding pair (Homozygoytes)	JAX
acrc:22000010	R26-FLPe	B6N.129S4-Gt(ROSA)26Sortm1(FLP1)Dym/JNcbs	Public	Live	Mus Musculus	Congenic, Targeted Mutation	JAX -> NCBS	JAX #016226	C57BL/6NJ background	Homozygote x Homozygote	Black Coat	FLPeR mice harbor the FLPe knock-in allele (R26Fki).		Friday, February 4, 2022	2 Males and 2 Females	JAX
acrc:22000045	R26-FLPe/+; Ai9/+	B6N.129S4-Gt(ROSA)26Sortm1(FLP1)Dym/JNcbs; B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/JNcbs [Ai9(RCL-tdT)]	Public	Live	Mus Musculus	Compound	JAX -> NCBS	R26-FLPe - JAX #016226; Ai9 - JAX#007909								JAX
acrc:21000253	R26fsTRAP	B6.129S4Gt(ROSA)26Sor<tm1(CAGEGFP/Rpl10a birA)Wtp>/JNcbs -[R26fsTRAP]	Public	Live	Mus Musculus	Targeted (Conditional ready (e.g. floxed), Reporter)	JAX	JAX# 22367	C57BL/6J	Homozygote x Homozygote OR Homozygote X C57BL/6J OR HET X HET	Black		yes	Wednesday, February 21, 2018	only 2 Males [to be bred with our C57BL/6J mice upon arrival]	JAX	These fs-TRAP mice are a useful tool for the isolation and purification of ribosome-bound proteins and protein complexes from tissues. HSG
acrc:21000284	R26p-Fucci2	R26p-Fucci2 (Tg/+): N11 [cell cycle (G1 & S/G2/M)]	Public	Cryo-E	Mus Musculus	Tg reporter [cell cycle (G1 & S/G2/M)]	RIKEN-CDB	CDB0203T	B6/N					Monday, January 29, 2018	2 cryo-vials	RIKEN-CDB	The R26p-Fucci2 is one in which the Rosa26 promoter (R26p) bidirectionally directs mCherry-hCdt1(30/120) and mVenus-hGem(1/110) in a single transgene- PMID: 23175634 (http://www.clst.riken.jp/arg/reporter_mice.html).
acrc:21000143	R26R	B6.129S4-Gt(ROSA)26Sortm1Sor/JNcbs	Public	Live, Cryo-S	Mus Musculus	Targeted (Conditional ready (e.g. floxed), Reporter)		JAX#003474							imported by CJ from UCSD?	JAX, ACRC	These Gt(ROSA)26Sortm1Sor targeted mutant mice carry a loxP flanked neo cassette upstream of a β-galactosidase (lacZ) sequence. Removal of the neo cassette by cre recombination results in lacZ expression in cre-expressing tissues of the offspring. These mutant mice may be used as a Cre-reporter strain to test the tissue/cellular expression pattern of cre expressing mice.
acrc:21000403	R26R, K14Snail (CD1)	B6.129S4-Gt(ROSA)26Sortm1Sor , K14Snail (CD1) / Ncbs	Public	Live	Mus Musculus	compound	ACRC	components of JAX#003474 and K14Snail (CD1) from Elaine Fuchs	mixed							JAX, Elaine Fuchs (Rockefeller University), Colin Jamora
acrc:21000300	R26R-Confetti	B6.129P2-Gt(ROSA)26Sortm1(CAG-Brainbow2.1)Cle/JNcbs -[R26R-Confetti]	Public	Live	Mus Musculus	Targeted (Conditional ready (e.g. floxed), Reporter)	JAX ->NCBS	JAX# 017492	C57BL/6J	recommended Het X Het - -- Homo X Homo are reported to be viable and fertile	black			Thursday, September 20, 2018	1 breeding pair (Homozygoytes)	JAX
acrc:21000278	R26R-Display-mCherry	R26R-Display-mCherry - DispC#26(loxp/loxp) [membrane]	Public	Cryo-E	Mus Musculus	targeted reporter [membrane]	RIKEN-CDB	CDB0207K	B6/N					Monday, January 29, 2018	2 cryo-vials	RIKEN-CDB	R26R reporter lines generated by inserting a series of cDNAs for fluorescent fusion proteins into the ROSA26 locus. the R26R alleles are the <conditional> loxP-PGKNeo pA-loxP alleles. (http://www.clst.riken.jp/arg/reporter_mice.html).
acrc:21000279	R26R-EB1-EGFP	R26R-EB1-EGFP = EB1G#71(loxp/loxp) [Microtubule]	Public	Cryo-E	Mus Musculus	targeted mutation [Microtubule]	RIKEN-CDB	CDB0213K	B6/N					Monday, January 29, 2018	2 cryo-vials	RIKEN-CDB	R26R reporter lines generated by inserting a series of cDNAs for fluorescent fusion proteins into the ROSA26 locus. the R26R alleles are the <conditional> loxP-PGKNeo pA-loxP alleles. (http://www.clst.riken.jp/arg/reporter_mice.html).
acrc:21000281	R26R-EGFP-Paxillin	R26R-EGFP-Paxillin [Gpaxillin#2(loxP/loxP)] [Focal contacts]	Public	Cryo-E	Mus Musculus	targeted reporter [Focal contacts]	RIKEN-CDB	CDB0221K	B6/N					Monday, January 29, 2018	2 cryo-vials	RIKEN-CDB	R26R reporter lines generated by inserting a series of cDNAs for fluorescent fusion proteins into the ROSA26 locus. the R26R alleles are the <conditional> loxP-PGKNeo pA-loxP alleles. (http://www.clst.riken.jp/arg/reporter_mice.html).
acrc:21000274	R26R-H2B-EGFP	R26R-H2B-EGFP [H2BG#42(loxp/loxp)]	Public	Live, Cryo-E, Cryo-S	Mus Musculus	targeted reporter [nucleus]	RIKEN-CDB	CDB0203K	B6/N					Monday, January 29, 2018	2 cryo-vials	RIKEN-CDB	R26R reporter lines generated by inserting a series of cDNAs for fluorescent fusion proteins into the ROSA26 locus. the R26R alleles are the <conditional> loxP-PGKNeo pA-loxP alleles. (http://www.clst.riken.jp/arg/reporter_mice.html).
acrc:24000036	R26R-hACE2 [6557]	R26R-hACE2 [6557]	Public	Cryo-S	Mus Musculus		MGEF		B6ND2
acrc:24000037	R26R-hACE2 [6665]	R26R-hACE2 [6665]	Public	Cryo-S	Mus Musculus		MGEF		B6ND2
acrc:21000285	R26R-Lyn-mCherry	R26R-Lyn-mCherry [#30(loxp/loxp)] [membrane]	Public	Cryo-E	Mus Musculus	targeted reporter [membrane]	RIKEN-CDB	CDB0278K	B6/N					Monday, January 29, 2018	2 cryo-vials	RIKEN-CDB	R26R reporter lines generated by inserting a series of cDNAs for fluorescent fusion proteins into the ROSA26 locus. the R26R alleles are the <conditional> loxP-PGKNeo pA-loxP alleles. (http://www.clst.riken.jp/arg/reporter_mice.html).
acrc:21000276	R26R-Lyn-Venus	R26R-Lyn-Venus/Lyn-Venus (loxP/loxP) [membrane]	Public	Cryo-E	Mus Musculus	targeted reporter [membrane]	RIKEN-CDB	CDB0219K	B6/N					Monday, January 29, 2018	2 cryo-vials	RIKEN-CDB	R26R reporter lines generated by inserting a series of cDNAs for fluorescent fusion proteins into the ROSA26 locus. the R26R alleles are the <conditional> loxP-PGKNeo pA-loxP alleles. http://www.clst.riken.jp/arg/reporter_mice.html
acrc:21000567	R26R-mito-DarT [#12]	B6N;DBA2-Rosa26^em2(LSL-DarT-FLAG-IRESeGFP)Mgef/Ncbs [from founder#12]	Public	Live, Cryo-S	Mus Musculus	crispr/Cas9 targeted knockIn	MGEF									MGEF / BLiSC, Raj Ladher	RajLadher Lab. MGEF project: Inj21_RL_Mona_R26-DarT-KI_609
acrc:22000027	R26R-mito-DarT [#12]; PGKCre	B6N;DBA2-Rosa26^em2(LSL-DarT-FLAG-IRESeGFP)Mgef/Ncbs [from founder#12]; Tg(Pgk1-cre)1Lni/Ncbs	Public	Live	Mus Musculus	Compound	R26R-mito-DarT [#12]- MGEF; PGKCre- Pasteur Institute Paris (Yvan Lallemand)	R26R-mito-DarT [#12]- MGEF RL lab , PGKCre- Pasteur Institute Paris (Yvan Lallemand) and MGI:2178050 ; also available as JAX#020811 (on B6)								PGKCre- Pasteur Institute Paris (Yvan Lallemand), JAX and R26R-mito-DarT [#12]- MGEF RL lab
acrc:21000566	R26R-mito-DarT [#1]	B6N;DBA2-Rosa26^em1(LSL-DarT-FLAG-IRESeGFP)Mgef/Ncbs [from founder#1]	Public	Live, Cryo-S	Mus Musculus	crispr/Cas9 targeted knockIn	MGEF									MGEF / BLiSC, Raj Ladher	RajLadher Lab. MGEF project: Inj21_RL_Mona_R26-DarT-KI_609
acrc:21000568	R26R-mito-DarT [#54]	B6N;DBA2-Rosa26^em3(LSL-DarT-FLAG-IRESeGFP)Mgef/Ncbs [from founder#54]	Public	Live, Cryo-S	Mus Musculus	crispr/Cas9 targeted knockIn	MGEF									MGEF / BLiSC, Raj Ladher	RajLadher Lab. MGEF project: Inj21_RL_Mona_R26-DarT-KI_609
acrc:21000277	R26R-Mito-EGFP	R26R-Mito-EGFP/MitoG#22(loxP/loxP)	Public	Cryo-E, Cryo-S	Mus Musculus	targeted reporter [mitochondria]	RIKEN-CDB	CDB0216K	B6/N							RIKEN-CDB	June 2018- Cryorecovery failed - two new CryoVials arrived 22 Nov2018- cryorecovered OK
acrc:21000478	R26R-Mito-EGFP, PGKCre	R26R-Mito-EGFP/MitoG#22, Tg(Pgk1-cre)1Lni/Ncbs	Public	Live	Mus Musculus		RIKEN CDB & Pasteur Institute Paris	compound of CDB0216K & MGI:2178050	mixed							RIKEN CDB , Pasteur Institute Paris
acrc:21000280	R26R-Venus-Actin	R26R-Venus-Actin [V actin#128(loxp/loxp)]	Public	Cryo-E	Mus Musculus	targeted reporter [Actin]	RIKEN-CDB	CDB0218K	B6/N					Monday, January 29, 2018	2 cryo-vials	RIKEN-CDB	R26R reporter lines generated by inserting a series of cDNAs for fluorescent fusion proteins into the ROSA26 locus. the R26R alleles are the <conditional> loxP-PGKNeo pA-loxP alleles. (http://www.clst.riken.jp/arg/reporter_mice.html).
acrc:21000283	R26R-ZO1-EGFP	R26R-ZO1-EGFP [#137(loxP/loxP)] [Tight Junctions]	Public	Live, Cryo-E, Cryo-S	Mus Musculus	targeted reporter [Tight Junctions]	RIKEN-CDB	CDB0225K	B6/N					Monday, January 29, 2018	2 cryo-vials	RIKEN-CDB	R26R reporter lines generated by inserting a series of cDNAs for fluorescent fusion proteins into the ROSA26 locus. the R26R alleles are the <conditional> loxP-PGKNeo pA-loxP alleles. (http://www.clst.riken.jp/arg/reporter_mice.html).
acrc:21000467	R26R-ZO1-EGFP, Sox10-Cre	R26R-ZO1-EGFP [#137(loxP/loxP)] [Tight Junctions], Tg(Sox10-cre)1Wdr/JNcbs	Public	Live	Mus Musculus		RIKEN-CDB & JAX	compound of CDB0225K & JAX# 025807	mixed							JAX, Riken-CDB (Kobe)	The Jackson Laboratory Sox10-Cre live colony in 2017 exhibits white belly spots (not linked to presence of the transgene).
acrc:21000075	Rag1KO	B6.129S7-Rag1tm1Mom/JNcbs	Public	Live, Cryo-S	Mus Musculus	Congenic, Targeted Mutation	JAX	Jax# 002216		Homozygote x Homozygote	black	immuno compromised	Y	Saturday, November 29, 2014	2 breeding pairs	Global JAX/NCBS/Instem transfer agreements_2017	SC
acrc:21000124	Rag1KO, Shiverer (F2)	B6.129S7-Rag1tm1Mom/J , C3Fe.SWV-Mbpshi/J (F2) [Ncbs]	Public	Live	Mus Musculus	compound, double mutant		components of JAX#002216 and JAX#001428		Rag1KO^+/-, Shiverer^+/- (F1) X Rag1KO^+/-, Shiverer^+/- (F1)							SC
acrc:21000261	Raldh2+/-; Raldh3+/-	Raldh2+/-; Raldh3+/- (B6D2 F1)	Public	Cryo-E	Mus Musculus		RIKEN-CDB import (Jan2018) - From Partanen Lab			B6D2 F1 X				Monday, January 29, 2018	1 CryoVial (= 60 2-cell embryos)	RIKEN + Partanen Lab
acrc:21000186	Rap fl/fl, Foxp3YFPCre,Il1r1 -/-	Rap fl/fl, Foxp3YFPCre, Il1r1 KO /[Ncbs]	Public	Live	Mus Musculus	coumpound	JAX - CJ	components of JAX# 013188 and JAX# 016959 and JAX# 003245									CJ
acrc:21000093	RaploxP	B6.Cg-Rptortm1.1Dmsa/JNcbs (Rap^loxP)	Public	Live, Cryo-S	Mus Musculus	Congenic, Targeted Mutation	JAX	JAX# 013188	B6	Homozygote x Homozygote			N				AS
acrc:21000305	RBPj flox	B6.129S2-Rbpj<tm1Kyo>/HonRbrcNcbs	Public	Live	Mus Musculus	Targeted Mutation Congenic	RIKEN- CDB- Mitsuru Morimoto	RBRC01101 - PMID:17681139	originaly on C57BL/6NCrSlc ? but litters have Black and Albino pups!!	(Heterozygote x C57BL/6N) - or Het X Het - Only Black animals should be used for mating	Mitsuru confirms that litters are black pups with occasional albino pups-	Homos are embryonic lethal - die by E10.5	YES	Thursday, November 22, 2018	1 vial of 2 cell vitrified embryos- Vitrified RIKEN on 2017.6.30 & MGEF cryorecovered Black and Albi pups on 28 May 2019	Mitsuru Morimoto - RIKEN-CDB	Developed by Dr. Honjo, Faculty of Medicine, Kyoto University in 1995. RBP-J, recombining binding protein suppressor of hairless (Drosophila) which is a transcriptional factor of a Notch/RBP-J signaling pathway play a role in fate determination in various lineages. RBP-J homozygous mutant mice show severe growth retardation at 8.5 days of gestation, incomplete turning of the body axis, microencephaly, abnormal placental development, anterior neuropore opening and defective somitogenesis at 9.5 days of gestation, and die before 10.5 days of gestation.
acrc:22000025	RBPj flox; Foxg1-cre [B6J]	B6.129S2-Rbpj<tm1Kyo>/HonRbrc; Foxg1-cre 129(Cg)-Foxg1tm1(cre)Skm/JNcbs XB6JNcbs	Public	Live	Mus Musculus	Compound	RBPj flox- RIKEN- CDB- Mitsuru Morimoto, Foxg1-cre [B6J]- RIKEN-CDB + From Jackson, 花嶋先生 lab - JAX#004337	RBPj flox-RBRC01101 - PMID:17681139, Foxg1-cre [B6J]- RIKEN-CDB + From Jackson, 花嶋先生 lab - JAX#004337
acrc:21000102	RCE	Gt(ROSA)26Sortm1.2(CAG-EGFP)Fsh/Ncbs [RCE:FRT]	Public	Live, Cryo-S	Mus Musculus	Targeted	Gordon Fishell (NY)	MGI:4420764 ; MMRRC Stock No: 32038-JAX								JAX, Gord Fishell, Harvard Medical School	HSG
acrc:21000053	ROSA nlacZ	Gt(ROSA)26Sor tm1(nls-lacZ)JFN/Ncbs	Public	Live, Cryo-S	Mus Musculus	Tg	JF Nicolas (Pasteur Institute Paris)			Homozygous breeding	White	8-12 pups per litter	N			JF Nicolas (Pasteur Institute Paris)	RS
acrc:21000292	Rosa26-DTA176	B6;129-Gt(ROSA)26Sortm1(DTA)Mrc/JNcbs	Public	Live, Cryo-S	Mus Musculus	Gene Trap, Targeted (Conditional ready (e.g. floxed), Inserted expressed sequence, No functional change)	JAX -> NCBS	JAX# 10527	original: (129X1/SvJ x 129S1/Sv)F1-Kitl+ ; mixed B6	Homozygote x Homozygote	agouti			Thursday, September 20, 2018	2 homozygote males	JAX
acrc:21000123	ROSACreERT2	B6.129-Gt(ROSA)26Sortm1(cre/ERT2)Tyj/JNcbs	Public	Cryo-S	Mus Musculus	Congenic, Targeted Mutation	JAX	JAX# 008463		Homozygote x Homozygote	black			Saturday, November 29, 2014	3 breeding pairs	JAX - NCBS relocation agreements	shared (RS, SR, JD)
acrc:21000312	ROSACreERT2/+, Lhx2cKO/+, BetaCat cKO/cKO	Gt(ROSA)26Sortm1(cre/ERT2)Tyj ; Lhx2tm1Monu ; Ctnn1b tm2Kem (beta Catenin)	Public	Cryo-S	Mus Musculus	compound	cryo for Shubha Tole (TIFR Mumbai) + JAX	compound from JAX#008463 + MGI:3772179 + JAX#004152 ;MGI:2148567	mixed - original Cryo males were agouti					Friday, November 25, 2016		Shubha Tole (TIFRmumbai) for Cryo Stocks, JAX
acrc:21000473	ROSACreERT2/+, Lhx2cKO/cKO	Gt(ROSA)26Sortm1(cre/ERT2)Tyj , Lhx2tm1Monu / Ncbs	Public	Live, Cryo-S	Mus Musculus		rederived from Shubha Tole Stocks- TIFR Mumbai	compound of JAX#008463 & MGI:3772179						Saturday, March 6, 2021		Shubha Tole (TIFRmumbai), JAX, BM	BM imported from TIFR Mumbai
acrc:21000513	ROSACreERT2/+, Lhx2cKO/cKO, Ai9/+	B6.129-Gt(ROSA)26Sortm1(cre/ERT2)Tyj/JNcbs, Lhx2tm1Monu/Ncbs, Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/Ncbs	Public	Live, Cryo-S	Mus Musculus	compound	rederived from Shubha Tole Stocks- TIFR Mumbai	compound of JAX# 008463, MGI:3772179, JAX#007909	mixed							JAX, Shubha Tole - TIFR Mumbai	BM
acrc:22000046	ROSACreERT2/+; Ai9/+	B6.129-Gt(ROSA)26Sortm1(cre/ERT2)Tyj/JNcbs; B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/JNcbs [Ai9(RCL-tdT)]	Public	Live	Mus Musculus	Compound	JAX -> NCBS	JAX# 008463; JAX#007909								JAX
acrc:21000002	ROSAmT/mG	B6.129(Cg)-Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo/JNcbs	Public	Cryo-S	Mus Musculus	congenic	JAX	JAX# 007676 ; MGI:3716464		Homozygous breeding	black	8-12 pups per litter	N (homozygote)		3 breeder pairs	Global JAX/NCBS/Instem transfer agreements_2017	Genotyping Primers: mTmG F: CTCGCTGCCTCCTGGCTTCT; mTmG R: CGAGGCGGATCACAAGCAATA; mTmG mutant: TCAATGGGCGGGGGTCGTT Mutant: 250 bps; Wild type: 350 bps
acrc:21000299	RphiGT	B6;129P2-Gt(ROSA)26Sortm1(CAG-RABVgp4,-TVA)Arenk/JNcbs	Public	Live	Mus Musculus	Targeted (Conditional ready (e.g. floxed), Reporter, Inserted expressed sequence)	JAX ->NCBS	JAX# 024708	mixed B6;129		black	During backcrossing, the Y chromosome was NOT fixed to the C57BL/6 genetic background.		Thursday, September 20, 2018	1 breeding pair (Homozygoytes)	JAX	important JAX note: Mice that are homozygous for the targeted mutation are viable and fertile. During backcrossing, the Y chromosome was NOT fixed to the C57BL/6 genetic background.
acrc:21000073	Rud lox	Rudhira lox / Ncbs (= Bcas3 lox ; breast carcinoma amplified sequence 3)	Public	Live, Cryo-S	Mus Musculus		RIKEN -> Ncbs		original: C57BL/6 × CBA (transgenic)	Homozygote X Homozygote	black						Stock Cryopreserved for Maneesha Inamdar (JNCSAR).
acrc:21000074	Rud-mCherry	Rudhira-mCherry (= Bcas3-mCherry)	Public	Cryo-S	Mus Musculus		RIKEN -> Ncbs		original: C57BL/6 × CBA (transgenic)	Hemizygote X Hemizygote	black					RIKEN- CDB, NCBS- Maneesha Inamdar ( JNCSAR)	Stock Cryopreserved for Maneesha Inamdar (JNCSAR).
acrc:21000108	Scgb1a1-CreER	B6N.129S6(Cg)-Scgb1a1tm1(cre/ERT)Blh/JNcbs	Public	Live, Cryo-S	Mus Musculus	Congenic, Targeted Mutation	JAX	JAX# 016225		Homozygote x Homozygote						Global JAX/NCBS/Instem transfer agreements_2017	AG
acrc:21000126	Scgb1a1-CreER, tdT	B6N.129S6(Cg)-Scgb1a1tm1(cre/ERT)Blh/J, B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J /[Ncbs]	Public	Live	Mus Musculus	compound, double targeted	JAX	compound of JAX#016225 and JAX#007914		Scgb1a1-CreER^Cre/Cre X tdTomatoAi14^tdT/tdT						JAX - NCBS relocation agreements	AG
acrc:21000327	Scnn1a-Tg3-Cre	B6;C3-Tg(Scnn1a-cre)3Aibs	Public	Cryo-S	Mus Musculus		cryo for Neeraj Jain (NBRC)	JAX#009613						Tuesday, November 20, 2018		Neeraj Jain (NBRC) for Cryo Stock, JAX
acrc:21000079	SD-12	SPRAGUE DAWLEY (2012 NCBS imported)	Public	Discontinued	Rattus norvegicus	WT			SD	WT X WT							Stocks imported in 2012 Discontinued in 2021 by SC Lab
acrc:21000209	SD-15	SPRAGUE DAWLEY (2015 NCBS imported)	Public	Discontinued	Rattus norvegicus	WT			SD	WT X WT							Stock imported to NCBS in 2015 Discontinued in Oct 2023
acrc:21000469	SD-21	Sprague Dawley (SD) [Feb 2021 Hylasco stocks]	Public	Live	Rattus norvegicus		Hylasco Hyderabad - Charles River	Crl:CD (SD) IGS (Crl#001)						Friday, February 26, 2021	10 Males + 10 Females
acrc:21000219	Sept7 fl/+; Stim1 fl/+; PCP2Cre/+	Sept7 flox/+; Stim1 flox/+; PCP2Cre/+	Public	Live	Mus Musculus
acrc:21000218	Sept7 fl/+; Stim1 fl/+; tdT/+	Sept7 flox/+; Stim1 flox/+; Ai14tdT/+	Public	Cryo-S	Mus Musculus
acrc:21000242	Sept7 fl/fl; PCP2Cre/+	Sept7 fl/fl; PCP2Cre/+	Public	Live	Mus Musculus
acrc:21000221	Sept7 fl/fl; Stim1 fl/fl; tdT/+; PCP2Cre/+	Sept7 flox/flox; Stim1 flox/flox; Ai14tdT/+ ;PCP2-Cre cre/+	Public	Live	Mus Musculus
acrc:21000222	Sept7 fl/fl; Stim1 fl/fl; tdT/tdT	Sept7 flox/flox; Stim1 flox/flox; Ai14tdT/tdT	Public	Live	Mus Musculus				MIXED
acrc:21000240	Sept7 fl/fl; tdT/tdT	Sept7 flox/flox; Ai14tdT/tdT	Public	Live	Mus Musculus
acrc:21000217	Sept7 flox/flox	Sept7 flox/flox	Public	Live	Mus Musculus
acrc:21000370	Sftpc-CreERT2	B6.129S-Sftpctm1(cre/ERT2)Blh/J	Public	Live	Mus Musculus	Targeted (Recombinase-expressing, Inducible)	JAX	JAX#028054	C57BL/6NJ + C57BL/6J	Homozygote X Homozygote	black			Friday, September 13, 2019	2 breeding pairs	JAX	When maintaining a live colony, these mice can be bred as homozygotes. Of note, the donating investigator reports that when continually maintained on the C57BL/6NCr genetic background, they observed spontaneous recombination levels up to 25%.
acrc:21000157	Shiverer	C3Fe.SWV-Mbpshi/JNcbs, (C3HeB/FeJ-shiverer)	Public	Live, Cryo-S	Mus Musculus	Congenic, Spontaneous Mutation	JAX	JAX# 001428		Homozygote (M) x Heterozygote (F)	black	lack of myelin - homozygous animals begin shivering by 2 months of age	Y			JAX	SC
acrc:24000052	Sirt1 delE2/+;Cre+;nnt+/-	Sirt1 delE2/+;Cre+;nnt+/-	Public	Cryo-S	Mus Musculus	Heterozygous	ULLAS_TIFR HYD		B6N/J
acrc:24000049	Sirt1 E4 lox/lox: Cre/Cre; nnt +/+	Sirt1lox/lox: Ert2 Cre/Cre; nnt+/+	Public	Live, Cryo-S	Mus Musculus	Homozygous	ULLAS_TIFR HYD		B6N/J
acrc:21000332	Sirt1 lox	B6;129-Sirt1 tm1Ygu	Public	Live, Cryo-S	Mus Musculus	Targetted KI	Cryo for Ullas Kolthur - TIFRmumbai - JAX	JAX#008041	C57BL/6NCrl					Thursday, January 12, 2017		Ullas Kolthur for Cryostocks, JAX	Note from Ullas: This was continuously backcrossed with C57BL/6NCrl for 9 generations. The Cryo males are progeny of intercrossing after 9th generations.
acrc:21000336	Sirt4 (-/-)	129-Sirt4tm1Fwa	Public	Cryo-S	Mus Musculus	targetted KO	Cryo for Ullas Kolthur - TIFRmumbai - JAX	JAX#012756	129S1/Sv					Tuesday, December 26, 2017		Ullas Kolthur for Cryo Stocks, JAX
acrc:21000335	Sirt6(+/-)	129-Sirt6tm1Fwa	Public	Cryo-S	Mus Musculus	Targeted Mutation - LacZ KO	Cryo for Ullas Kolthur - TIFRmumbai - JAX	JAX#006050	129:B6					Sunday, November 20, 2016		Ullas Kolthur for Cryo Stocks, JAX	This mutant mouse strain contains a lacZ gene knock-in resulting in a loss of function of the targeted allele and may be useful in studies of DNA damage repair, genomic stability, and aging.
acrc:22000089	Six1-Cre; RBPj flox	B6N Six1-Cre/+ (B6N) [mSix1-21-NLSCre]; B6.129S2-Rbpj<tm1Kyo>/HonRbrcNcbs	Public	Live	Mus Musculus	Compound	RIKEN-CDB to ACRC	RBPj flox-RBRC01101 - PMID:17681139,								RIKEN-CDB, RBPj flox from Mitsuru Morimoto
acrc:22000088	Six1-Cre;Jag1-flox	B6N Six1-Cre/+ (B6N) [mSix1-21-NLSCre]; B6;129S-Jag1tm2Grid/JNcbs	Public	Live	Mus Musculus	Compound	Six1-Cre- RIKEN-CDB + from Dr Shigeru Sato in Jichi Med Univ; Jag1-flox- JAX	Six1-Cre- RIKEN-CDB + from Dr Shigeru Sato in Jichi Med Univ; Jag1-flox =JAX#010618								RIKEN-CDB, JAX
acrc:21000293	SLICK-H	STOCK Tg(Thy1-cre/ERT2,-EYFP)HGfng/PyngJNcbs	Public	Live, Cryo-S	Mus Musculus	Transgenic (Recombinase-expressing, Reporter, Inducible)	JAX	JAX# 12708	mixed: (C57BL/6J ; CBA) - backcrossed to C57BL/6J for 4generations by JAX	Hemizygous X sibling non-carriers or Hemizygous X C57BL/6J	black			Thursday, September 20, 2018	2 hemizygote males	JAX
acrc:21000148	Snail fl/fl, K14 Cre	Snail fl/fl, K14 Cre	Public	Live, Cryo-S	Mus Musculus												CJ
acrc:21000301	Sox10-Cre	B6;CBA-Tg(Sox10-cre)1Wdr/JNcbs	Public	Live, Cryo-S	Mus Musculus	Transgenic (Recombinase-expressing)	JAX ->NCBS	JAX# 025807	B6;CBA	Noncarrier x Hemizygote OR Hemizygote x Noncarrier	black			Thursday, September 20, 2018	1 breeding pair (Hemizygoytes)	JAX	The Jackson Laboratory live colony in 2017 exhibits white belly spots (not linked to presence of the transgene).
acrc:21000476	Sox10-Cre, R26R-Confetti	B6;CBA-Tg(Sox10-cre)1Wdr/JNcbs, B6.129P2-Gt(ROSA)26Sortm1(CAG-Brainbow2.1)Cle/JNcbs -[R26R-Confetti]	Public	Live	Mus Musculus	compound	JAX -> NCBS	compound of JAX# 025807 & JAX# 017492	mixed							JAX
acrc:21000443	Sox2 loxP	STOCK Sox2tm1.1Lan/JNcbs	Public	Live	Mus Musculus	Targeted (Conditional ready (e.g. floxed), No functional change)	JAX	JAX#013093	mixed	Homozygote MALES x HET females is recommended ; HOMO X HOMO are very poor breeders			YES	Friday, November 27, 2020	3 Males	JAX	From Jax: "When maintaining a live colony, homozygous mice may be bred together. It is the experience of colonists at The Jackson Laboratory that homozygous breeding pairs produce few offspring, as does breeding heterozygous females with homozygous males. Therefore, we also maintain this strain by breeding homozygous females with heterozygous males.
acrc:21000464	Sox2 loxP, Atoh1-cre/ESR1	Sox2tm1.1Lan/JNcbs, Atoh1-cre/ESR1/Ncbs (FVB/N)	Public	Live	Mus Musculus		RIKEN & JAX	compound of JAX#013093 & JAX#007684	mixed							JAX	Sox2LoxP HOMO X Sox2LoxP HOMO are very poor breeders- - RL
acrc:21000465	Sox2 loxP, B6J	Sox2tm1.1Lan/JNcbs, B6/JNcbs(2019)	Public	Live	Mus Musculus		JAX	compound of JAX#013093 & JAX#000664								JAX	Sox2LoxP HOMO X Sox2LoxP HOMO are very poor breeders-
acrc:21000462	Sox2 loxP, PGKCre	Sox2tm1.1Lan/JNcbs , Tg(Pgk1-cre)1Lni/Ncbs	Public	Live	Mus Musculus		JAX & Pasteur Institute Paris (Yvan Lallemand)	compound of JAX#013093 & MGI:2178050	mixed	Sox2LoxP/LoxP Homo X homo breeding to be avoided						JAX, Pasteur Institute Paris (Yvan Lallemand)	Sox2LoxP HOMO X Sox2LoxP HOMO are very poor breeders- - RL
acrc:21000463	Sox2 loxP, PLPcreER	Sox2tm1.1Lan/JNcbs, Tg(Plp1-cre/ERT)3Pop/JNcbs	Public	Live	Mus Musculus		JAX	compound of JAX#013093 and JAX# 005975	mixed							JAX	Sox2LoxP HOMO X Sox2LoxP HOMO are very poor breeders- - RL
acrc:21000480	Sox2 loxP; Emx2-Cre	Sox2tm1.1Lan/JNcbs ; Emx2-Cre [Riken]	Public	Live	Mus Musculus		JAX -> NCBS & RIKEN-CDB	compound of JAX#013093 & CDB0020K	mixed							JAX, Riken-CDB (Kobe)
acrc:21000498	Sox2 loxP; Lgr5-EGFP	STOCK Sox2tm1.1Lan/JNcbs; B6.129P2-Lgr5tm1(cre/ERT2)Cle/JNcbs	Public	Live	Mus Musculus		JAX	compound of JAX#013093 & JAX#008875								JAX
acrc:21000250	Sst-IRES-Cre	B6N.CgSst<tm2.1(cre)Zjh>/J	Public	Live, Cryo-S	Mus Musculus	Targeted (Recombinase-expressing)	JAX	JAX# 18973	B6N	Heterozygote x Wild-type OR Wild-type x Heterozygote or HET X HET	Black			Wednesday, February 21, 2018	2 (HET X WT) breeding pairs	JAX	@JAX- Mice were bred to C57BL/6NJ inbred mice (Stock No. 005304) for many generations using a marker-assisted, speed congenic approach to generate this C57BL/6NJ-congenic strain. When maintaining the live congenic colony, homozygous mice may be bred together. Researchers may consider using heterozygous Sst-IRES-Cre mice in behavioral studies; please see strain description for more details. USB
acrc:21000035	Stim1 flox	Stim1^tm1Rao/Ncbs (= Stim1 Floxed)	Public	Live	Mus Musculus	Targeted (Conditional ready, No functional change)	Anjana Rao Lab, La Jolla Institute (CA)	MGI:3778911		Homozygote x Homozygote	black		Yes		3 breeding pairs	Anjana Rao Lab, La Jolla Institute (CA)	GH
acrc:21000153	Stim1fl/+, tdTAi14/+	Stim1^tm1Rao/Ncbs (= Stim1 Floxed), B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J (=tdTomatoAi14) / Ncbs	Public	Live, Cryo-S	Mus Musculus		JAX and Anjana Rao	compound of JAX# 007914 and MGI:3778911								JAX, Anjana Rao Lab, La Jolla Institute (CA),, Gaiti Hasan	GH
acrc:21000198	Stim1fl/fl, Pcp2Cre/+	Stim1^flox/flox, Pcp2^Cre/+ / Ncbs	Public	Live	Mus Musculus	compound	Anjana Rao Lab and JAX	components of MGI:3778911 and JAX# 004146								Anjana Rao Lab and JAX	GH
acrc:21000197	Stim1fl/fl, tdT/+, PCP2-Cre/+	Stim1fl/fl, tdT/+, PCP2-Cre/+	Public	Live	Mus Musculus	compound											GH
acrc:21000154	Stim1fl/fl, tdT/tdT	Stim1fl/fl, tdT/tdT / Ncbs	Public	Live	Mus Musculus												GH
acrc:21000427	Tbet-cre	B6;CBA-Tg(Tbx21-cre)1Dlc/J [ Tbet-cre ]	Public	Cryo-S	Mus Musculus		JAX -> ACRC	JAX#024507						Thursday, August 27, 2020	2 sperm straws	JAX to TIFRHyd, Adish Dani (TIFR Hyd)	Cryo Sperm imported from JAX for Adish Dani on 27 August 2020.
acrc:21000047	TBra	B6 x B6Ei.Cg-TWis/EiJNcbs (Brachyury mutant)	Public	Live, Cryo-S	Mus Musculus	Congenic Spontaneous Mutation	JAX	JAX# 004591		(f)TBra(het) x (m)B6D2F1; or (f)B6D2F1 x (m)TBra(het) (C57Bl/6J)	Black	8 to 12 pups per litter	N			Global JAX/NCBS/Instem transfer agreements_2017	RS; phenotyped screening:?
acrc:21000084	TBra:Myf5nlacZ	B6 x B6Ei.Cg-TWis/EiJ, Myf5tm1Pas /[Ncbs]	Public	Live	Mus Musculus	double - Targeted / compound	JAX and Pasteur Institute Paris	components of JAX# 004591 and MGI:1857973 [JAX# 018626]		TBra X Myf5nlacZ						JAX, Ramkumar Sambasivan	RS
acrc:21000044	Tbx6Cre	Tg(Tbx6Cre)rsa/Ncbs	Public	Live, Cryo-S	Mus Musculus	Tg	RS lab (Pasteur Institute Paris)		B6D2 ?	Tbx6-Cre X B6D2 F1	Black	8-12 pups per litter	Y			RS lab (Pasteur Institute Paris)	RS different lines- Tbx6Cre#5 Tbx6Cre#4
acrc:21000046	Tbx6YFP	Tbx6tm2(HIST1H2BB/EYFP)Pa/Ncbs	Public	Live, Cryo-S	Mus Musculus	KO, KI		MGI:3798467 ; 043813-JAX		(f)Tbx6YFP/+ x (m)B6D2F1 or (f)B6D2F1 x (m)Tbx6YFP/+	Black, grey or coco		Y			virginia papaioannou, MMRC - JAX	RS
acrc:21000087	Tbx6YFP:Myf5nlacZ	Tbx6tm2(HIST1H2BB/EYFP)Pa, Myf5tm1Pas /[Ncbs]	Public	Live	Mus Musculus			components of MGI:3798467 [043813-JAX ], and MGI:1857973 [JAX# 018626]								JAX, Ramkumar Sambasivan	RS
acrc:21000045	TCre	Tg(TCre)rsa/Ncbs	Public	Live, Cryo-S	Mus Musculus	Tg	RS lab (MRI)		FVB/NJ?	Homozygous breeding on FVB/NJ background	white	8 to 12 pups per litter	Y			Ramkumar Sambasivan	RS
acrc:21000244	TCre; betaCat-Flox	Tg(TCre)rsa/Ncbs ; B6.129-Ctnnb1tm2Kem/Ncbs	Public	Live	Mus Musculus	compound, cKO	Rolf Kemler, MPI-IE Freiburg (NCBS imported via Shubha Tole-TIFR Mumbai) and RS lab (MRI)	components of MGI:2148567 and	MIXED					Wednesday, September 14, 2016		Rolf Kemler, MPI-IE Freiburg , Ramkumar Sambasivan
acrc:21000257	tdT, betaCat-loxEx3	tdTomatoAi14, Ctnn1b tm1Mmt (beta-Catenin GOF)	Public	Live	Mus Musculus	compound	JAX and Makoto Mark Taketo, Kyoto University	compound of JAX# 007914 and MGI:1858008	mixed							JAX-, Makoto Mark Taketo, Kyoto University and Ramkumar Sambasivan direct agreement-	RS
acrc:21000152	tdT/+, PCP2-Cre/+	tdTAi14/+, PCP2-Cre/+ /[Ncbs]	Public	Live	Mus Musculus												GH
acrc:21000040	tdTomatoAi14	B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/JNcbs (tdT or tdTAi14)	Public	Live, Cryo-E, Cryo-S	Mus Musculus	Congenic; Gene Trap; Targeted Mutation	JAX	JAX# 007914	B6/J	Homozygote x Homozygote	black				2 breeders	Global JAX/NCBS/Instem transfer agreements_2017	MMP, SC, AG, GH, ACRC
acrc:21000199	Thy1-EGFP	STOCK Tg(Thy1-EGFP)MJrs/JNcbs [Thy1-GFP line M]	Public	Live, Cryo-S	Mus Musculus	Transgenic, Random Insertion	JAX stock but imported to NCBS from IISc (Dr. Balaji, CNS) Bangalore - Nov2016	JAX#007788	mixed/unknowm from IISc (initially created on (C57BL/6J x CBA)F1 background	recommended: Noncarrier x Hemizygote				Saturday, November 12, 2016	rederived from IISc (Dr. Balaji, CNS) colony		JAX notes: When maintaining a live colony, hemizygous mice may be bred to wildtype (noncarrier) siblings. The donating investigator suggests that backcrossing these mice onto the C57BL/6 genetic background may lead to breeding difficulties. (Initially wrongly imported and mentioned as from JAX #011070 Thy1-eGFP-S line - )
acrc:21000156	Tie2Cre (Flv)	B6.Cg-Tg(Tek-cre)12Flv/JNcbs	Public	Live, Cryo-S	Mus Musculus	Congenic, Transgenic (Recombinase-expressing)	JAX	JAX# 004128		C57BL/6J x Hemizygote OR Hemizygous x C57BL/6J	black		Y		4 males + 4 females (26-Feb-2009)	JAX - NCBS relocation agreements	Stock Cryopreserved for Maneesha Inamdar (JNCSAR).
acrc:22000044	TM-E22-FL-ALS	FVB/NJ-Tg(C9orf72)500Lpwr/JNcbs [C9-500 also named as C9orf72-ALS]; C57BL/6-Tmem119em1(cre/ERT2)Gfng/JNcbs, Tcf4tm1.1Hmb (E2-2-)/Ncbs	Public	Live	Mus Musculus	Compound	JAX									JAX
acrc:22000039	Tm-ifnar-fl	B6(Cg)-Ifnar1tm1.1Ees/JNcbs / interferon (alpha and beta) receptor 1; C57BL/6-Tmem119em1(cre/ERT2)Gfng/JNcbs, Tcf4tm1.1Hmb (E2-2-)/Ncbs	Public	Live	Mus Musculus	Compound	Ifnar1-fl- JAX, Tmem119-CreERT2, E2-2- JAX and Dan Holmberg (Sweden)									JAX
acrc:22000043	TM-IFNB-E22-FL	B6.129-Ifnb1tm1Lky/JNcbs [Ifnb-mob or Ifnb-EYFP]; C57BL/6-Tmem119em1(cre/ERT2)Gfng/JNcbs, Tcf4tm1.1Hmb (E2-2-)/Ncbs	Public	Live	Mus Musculus	Compound	JAX									JAX
acrc:22000040	TM-IFNGR-FL	C57BL/6N-Ifngr1tm1.1Rds/JNcbs ; interferon gamma receptor 1; C57BL/6-Tmem119em1(cre/ERT2)Gfng/JNcbs, Tcf4tm1.1Hmb (E2-2-)/Ncbs	Public	Live	Mus Musculus	Compound	JAX									JAX
acrc:21000485	Tmem119-CreERT2	C57BL/6-Tmem119em1(cre/ERT2)Gfng/JNcbs	Public	Live	Mus Musculus	Coisogenic, Endonuclease-Mediated Mutation	JAX -> NCBS	JAX# 031820						Thursday, April 15, 2021	2 males	JAX
acrc:21000564	Tmem119-CreERT2, E2-2	C57BL/6-Tmem119em1(cre/ERT2)Gfng/JNcbs, Tcf4tm1.1Hmb (E2-2-)/Ncbs	Public	Live, Cryo-S	Mus Musculus	Endonuclease-Mediated Mutation, Targeted Mutation	JAX and Dan Holmberg (Sweden)	JAX# 031820 and MGI:3798811	mixed							JAX, Dan Holmberg (Sweden)
acrc:22000042	TmtdAi14- e22-fl	C57BL/6-Tmem119em1(cre/ERT2)Gfng/JNcbs; B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/JNcbs (tdT or tdTAi14); Tcf4tm1.1Hmb (E2-2-)/Ncbs	Public	Live	Mus Musculus	Compound	JAX									JAX
acrc:21000085	Twist1 flox	Twist1tm2Bhr/Ncbs	Public	Live, Cryo-S	Mus Musculus	Targeted (Conditional ready, No functional change)	Richard R Behringer	MGI:3768516								Richard R Behringer	RS
acrc:21000194	Twist1 flox-HET	Twist1tm2Bhr, B6D2	Public	Live	Mus Musculus	Targeted (Conditional ready, No functional change)	Richard R Behringer	MGI:3768516, B6D2	mixed. B6D2	Twist1 flox X B6D2F1						Richard R Behringer	RS
acrc:21000180	Upk3aGCE/+, tdT/+	B6;DBA-Tg(Upk3a-GFP/cre/ERT2)26Amc/J, B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J (=tdTomatoAi14) / [Ncbs]	Public	Live, Cryo-S	Mus Musculus	double - transgenic,Targeted / compound	Boston University / JAX	components of JAX# 007914 and JAX# 015855	B6/J & DBA					Tuesday, February 16, 2016	2F + 2M	Global JAX/NCBS/Instem transfer agreements_2017	AG Compound strain imported from Boston University with JAX relocation agreement
acrc:21000429	V2R-GFP	STOCK Vmn2r26tm1Mom/MomJ [ V2r1b-IRES-tauGFP, V2R-GFP ]	Public	Live, Cryo-S	Mus Musculus	Targeted (Reporter)	JAX -> ACRC	JAX#006657						Thursday, August 27, 2020	2 sperm straws	JAX to TIFRHyd, Adish Dani (TIFR Hyd)	Cryo Sperm imported from JAX for Adish Dani on 27 August 2020. - 2straws received -
acrc:23000032	V2RP5-Cre	V2RP5-Cre	Public	Reviving	Mus Musculus				C57BL/6J					Thursday, March 30, 2023
acrc:21000272	Vangl2	LPT/LeJNcbs [Vangl2Lp = VANGL planar cell polarity 2 - Loop tail]	Public	Live, Cryo-S	Mus Musculus	spontaneous mutation	RIKEN-CDB + JAX	JAX# 000220??? OR JAX# 013121??? => to clarify by sequencing?	mentions CD1 on riken import file??? should be b6J?					Monday, January 29, 2018	1 CryoVial (= 63 2-cell embryos)	JAX relocation agreement for JAX# 000220	the loop tail mutation of the Vangl2 gene in causing neurodevelopmental defects leading to short, curly tails and spina bifida. There is incomplete penetrance and prenatal and perinatal lethality. Some heterozygous with mild spina bifida survive to adulthood and have bred. Some heterozygous females have closed vaginas. __ JAX Stock#000220 carries a transition point mutation that alters a G to an A at coding nucleotide 1391 (c.1391G>A). This is predicted to alter serine 464 to asparagine (p.S464N) in the encoded protein.Western blot analysis indicates an approximate 80% reduction in protein expression in homozygotes and downward shift in molecular mass that is emulated by dephosphorylation of the wild-type protein. __ JAX stock#013121 is a spontaneous mutation is an A-to-G (T-to-C on forward strand) substitution in the 5' UTR.
acrc:21000471	Vangl2, Sox10-Cre	LPT/LeJNcbs, B6;CBA-Tg(Sox10-cre)1Wdr/JNcbs [Vangl2Lp = VANGL planar cell polarity 2 - Loop tail]	Public	Live	Mus Musculus		JAX -> NCBS	compound of JAX# 000220 (or 013121???) and JAX# 025807	mixed							JAX
acrc:21000385	Vangl2-FLOX	B6;129-Vangl2tm2.1Mdea/JNcbs	Public	Live, Cryo-S	Mus Musculus	targeted mutation	JAX -> ACRC	JAX#025174	mixed					Wednesday, November 27, 2019		JAX	These floxed mutant mice possess loxP sites flanking exons 2 and 3 of the Vangl2 gene. This strain may be useful for generating conditional mutations in applications related to planar cell polarity.
acrc:21000499	Vangl2-FLOX; Lgr5-EGFP	B6;129-Vangl2tm2.1Mdea/JNcbs; B6.129P2-Lgr5tm1(cre/ERT2)Cle/JNcbs	Public	Live	Mus Musculus			compund of JAX#025174 & JAX#008875								JAX
acrc:21000533	Vangl2-FLOX; tdTomatoAi14	B6;129-Vangl2tm2.1Mdea/JNcbs; B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/JNcbs (tdT or tdTAi14)	Public	Live	Mus Musculus	Compound	JAX -> ACRC	Vangl2-FLOX- JAX#025174: tdTomatoAi14- JAX# 007914	MIXED							JAX
acrc:21000532	Vangl2-FLOX; Vangl2, Sox10-Cre	B6;129-Vangl2tm2.1Mdea/JNcbs; LPT/LeJNcbs, B6;CBA-Tg(Sox10-cre)1Wdr/JNcbs [Vangl2Lp = VANGL planar cell polarity 2 - Loop tail]	Public	Live	Mus Musculus	Compound	JAX--> ACRC	Vangl2,Sox10Cre-compound of JAX# 000220 (or 013121???) and JAX# 025807, Vangl2-flox-JAX#025174	Mixed							JAX
acrc:23000026	Vangl2;Gpsm2	LPT/LeJNcbs,(B6)3 : Gpsm2	Public	Live	Mus Musculus	Mixed(spontaneous mutation + transgenic)	RIKEN-CDB+JAX	JAX# 000220;	B6J	HetXHet	Agouti						the loop tail mutation of the Vangl2 gene, sometimes animal may born blind
acrc:23000028	Vangl2;lgr5	LPT/LeJNcbs;B6.129P2-Lgr5tm1(cre/ERT2)Cle/JNcbs	Public	Live	Mus Musculus	Compound(spontaneous mutation + transgenic)	RIKEN-CDB + JAX	JAX# 000220;JAX#008875	B6J	HetXHet	Black	homozygous lethal					the loop tail mutation of the Vangl2 gene
acrc:21000512	Vangl2;Ngn1-457Cre	LPT/LeJNcbs [Vangl2Lp = VANGL planar cell polarity 2 - Loop tail]; STOCK Tg(Neurog1-cre)1Jejo/JNcbs	Public	Live	Mus Musculus	Compound	Vangl2- RIKEN-CDB + JAX--> ACRC, Ngn1-457Cre - JAX --> ACRC	Vangl2- JAX# 013121??? or JAX# 000220??? to clarify by sequencing?, Ngn1-457Cre- JAX#012859
acrc:22000037	Vangl2;ZO1-EGFP-R26	LPT/LeJNcbs [Vangl2Lp = VANGL planar cell polarity 2 - Loop tail]; R26-ZO1-EGFP [Tight Junctions]	Public	Live	Mus Musculus	Compound	Vangl2- RIKEN-CDB + JAX, ZO1-EGFP-R26- RIKEN-CDB									RIKEN-CDB + JAX
acrc:21000394	Vav-iCre	B6N.Cg-Tg(Vav1-icre)A2Kio/JNcbs [Vav-iCre]	Public	Cryo-S	Mus Musculus		JNCASR - MI	JAX# 018968						Wednesday, January 8, 2020		JAX, Maneesha Inamdar (JNCSAR)	Stock Cryopreserved for Maneesha Inamdar (JNCSAR).
acrc:23000033	Vglut1-Cre	B6;129S-Slc17a7tm1.1(cre)Hze/J	Public	Cryo-S	Mus Musculus		Arnab Barik-IISc		C57BL/6J						2 males issued for cryopreservation on 9 Apr 2023
acrc:21000381	VGlut3-KO	B6;129S2-Slc17a8tm1Edw/JNcbs [VGlut3-KO]	Public	Cryo-S	Mus Musculus	Targeted KI	Cryo Sperm imported by TIFRHyd- Adish Dani - from Mark Rutherford - also available at JAX	JAX#016931						Wednesday, July 10, 2019	3 Cryo sperm straws	Adish Dani- TIFR Hyd, JAX	1) Cryo Stocks imported for Adish Dani- TIFR Hyderabad. 2) Stock Cryo-recovered at MGEF via IVF on B6/JNcbs background in September 2019- > transferred to TIFR Hyderabad
acrc:21000060	Vinc fl	B6.129S4(Cg)-Vcltm1Ross/JNcbs [ vinculin flox]	Public	Live	Mus Musculus		Jamora Lab	JAX#028451			black	6-9 pups per litter	Yes			Jamora, Ross-UCSD, JAX	CJ; SR
acrc:21000029	Vinc fl, K14Cre	vinculin fl/fl, K14-Cre (C57B6?) /[Ncbs]	Public	Live	Mus Musculus		Ross (UCSD)/Jamora	components of JAX#28451					Yes			Ross (UCSD)/Jamora	CJ
acrc:22000009	Vinc fl; Emx2-Cre	B6.129S4(Cg)-Vcltm1Ross/JNcbs [ vinculin flox]; Emx2-Cre/+ [RIKEN]	Public	Live	Mus Musculus	Compound	Vincl Fl- CJ lab (JAX#028451), Emx2-Cre - RIKEN-CDB	Vincl Fl- CJ lab (JAX#028451), Emx2-Cre - RIKEN-CDB ( CDB0020K)								Emx2-Cre - (RIKEN-CDB), Vinc fl - (Jamora, Ross-UCSD JAX),
acrc:22000061	Vinc fl; Sox10-Cre	B6.129S4(Cg)-Vcltm1Ross/JNcbs [ vinculin flox]; B6;CBA-Tg(Sox10-cre)1Wdr/JNcbs	Public	Live	Mus Musculus	Compound	Vincl Fl- CJ lab (JAX#028451), Sox10 Cre- RL lab (JAX# 025807)	Vincl Fl- CJ lab (JAX#028451), Sox10 Cre- RL lab (JAX# 025807)								JAX
acrc:21000210	WISTAR-15	WISTAR- (2015 NCBS imported)	Public	Live	Rattus norvegicus	WT			WIS	WT X WT							Stocks imported to NCBS in 2015
acrc:21000251	Wnt1-Cre2	129S4.CgTg(Wnt1cre)2Sor/JNcbs	Public	Cryo-S	Mus Musculus	Transgenic +Null/Knockout, (Recombinase-expressing)	JAX	JAX# 22137	129S4	Hemizygote x Noncarrier OR Noncarrier x Hemizygote	agouti	@JAX- hemizygous mice may be bred together, to wildtype siblings, or to 129S4/SvJaeJ inbred mice (Stock No. 009104)- BUT take note that homozygotes result in a functional knock-out of E2f1 gene.		Wednesday, February 21, 2018	2 (Noncarrier X Hemi) breeding pairs	JAX, Ramkumar Sambasivan	@JAX- The transgene integrated into chromosome 2 causing a 257 bp deletion and a 45 Kb inverted segment in exon 5 of the E2f1 (E2F transcription factor 1) gene. The inversion contains all of exon 5, but deletes 23 Kb including exons 6 and 7. The deletion results in a functional knock-out of E2f1 in homozygous mice. RS
acrc:21000539	ZO1-EGFP-R26	R26-ZO1-EGFP [Tight Junctions]	Public	Live	Mus Musculus	Constutive expressing ZO1-EGFP (Tight junctions)	RIKEN-CDB		B6/N							RIKEN-CDB	R26R-ZO1-EGFP (Stock id-#CDB0225K) was crossed with PGK cre (stock id-MGI:2178050). From the F1 litter, mice positive for EGFP and PGK cre was selected and crossed with littermate of the same genotype. In the F2 generation, Mice positive for EGFP and negative for PGK cre was selected. The F2 generation mice is thereafter scientifically named R26-ZO1-EGFP. To avoid confusion in the ACRC facility it is termed as Z01-EGFP-R26. (Details Given by Anubhav (RL lab))
acrc:21000490	αMHC-MerCreMer	B6.FVB(129)-A1cfTg(Myh6-cre/Esr1*)1Jmk/JNcbs [αMHC-MerCreMer]	Public	Live, Cryo-S	Mus Musculus	Congenic, Transgenic	JAX -> NCBS	JAX# 005657						Thursday, April 15, 2021	2 males	JAX	The alpha-MHC-MerCreMer (αMHC-MerCreMer) transgene has the mouse cardiac-specific alpha-myosin heavy chain promoter (αMHC or alpha-MHC; Myh6) directing expression of a tamoxifen-inducible Cre recombinase (MerCreMer) to juvenile and adult cardiac myocytes. -- The MerCreMer double fusion protein has substantially greater Cre recombinase activity with less promiscuity compared with the CreMer single fusion protein.

Animal Colony Management System (ACoMaS)

You are here

Animal Strain view